Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18613
Trapped Gene
B4galt1 (ENSMUSG00000028413)
Vector Insertion
Chr 4: 40759906 - 40770471
Public Clones (cmhd) IST13128B12 (tigm) IST14488D3 (tigm)
Private Clones OST419684 (lexicon) OST368903 (lexicon) OST322625 (lexicon)
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000178953 (Chr4:40770472..40770707 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCATCCCATTCCGTAACC Chr4:40770561..40770580 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000178953 (Chr4:40770472..40770707 -)
Downstram Exon
ENSMUSE00000178949 (Chr4:40759718..40759905 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCATCCCATTCCGTAACC Chr4:40770561..40770580 60.01 50 AAACCCGAACTTGTCCATTG Chr4:40759698..40759717 59.83 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000437529 Chr4:40800424..40801031 GGCGTCACCCTCGTCTATTA Chr4:40800717..40800736 60.1 55
upstream ENSMUSE00000178953 Chr4:40770472..40770707 CATCATCCCATTCCGTAACC Chr4:40770561..40770580 60.01 50

*** Putative Vector Insertion (Chr 4: 40759906 - 40770471) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000178949 Chr4:40759718..40759905 AAACCCGAACTTGTCCATTG Chr4:40759698..40759717 59.83 45
downstream ENSMUSE00000178956 Chr4:40756712..40756834 CCATTGATGGCAAGAAACTG Chr4:40756744..40756763 59.12 45
downstream ENSMUSE00000675552 Chr4:40756359..40756437 AAGCTCTTGTGCTTGCAGGT Chr4:40756339..40756358 60.2 50
downstream ENSMUSE00000178955 Chr4:40754766..40754870 CTCTTGAATGCCGGATCATT Chr4:40754772..40754791 60.04 45
downstream ENSMUSE00000297378 Chr4:40751635..40754350 CATGTTGACACCAGGGTGAG Chr4:40751918..40751937 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATTAATCGCCTTGCAGCAC Chr4:40767403..40767423 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGTGAGGTTTGGGAAGTG Chr4:40767453..40767473 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGGACTTTTAATCGCCTTGC Chr4:40767645..40767665 60.21 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATGACATCTCCCAGTGGACA Chr4:40767735..40767755 58.89 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028413