Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18614
Trapped Gene
Anp32a (ENSMUSG00000032249)
Vector Insertion
Chr 9: 62219677 - 62219868
Public Clones not available
Private Clones OST419669 (lexicon) OST232591 (lexicon) OST215510 (lexicon) OST200800 (lexicon)
OST185976 (lexicon) OST112153 (lexicon) OST215 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000533124 (Chr9:62219527..62219676 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTGAAGGCAAAATCGAAGG Chr9:62219560..62219579 59.16 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000533124 (Chr9:62219527..62219676 +)
Downstram Exon
ENSMUSE00000218105 (Chr9:62219869..62219991 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTGAAGGCAAAATCGAAGG Chr9:62219560..62219579 59.16 40 AGCGGCTCTATTGTGCTGAG Chr9:62219993..62220012 60.7 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697649 Chr9:62189189..62189361 GGGTTCGGGGTTTATTGATT Chr9:62189241..62189260 59.89 45
upstream ENSMUSE00000533124 Chr9:62219527..62219676 ATTGAAGGCAAAATCGAAGG Chr9:62219560..62219579 59.16 40

*** Putative Vector Insertion (Chr 9: 62219677 - 62219868) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000218105 Chr9:62219869..62219991 AGCGGCTCTATTGTGCTGAG Chr9:62219993..62220012 60.7 55
downstream ENSMUSE00000330921 Chr9:62221292..62221484 CCTGTCATAGCCATCGAGGT Chr9:62221417..62221436 60.1 55
downstream ENSMUSE00000218111 Chr9:62222461..62222558 CCTCCTCTCCACTCACATCC Chr9:62222559..62222578 59.64 60
downstream ENSMUSE00000218104 Chr9:62225107..62225170 TCCCCGTCATTGTAACCTTC Chr9:62225138..62225157 59.79 50
downstream ENSMUSE00000636265 Chr9:62225361..62225698 GGTTCTCGTTTTCGCTTCTG Chr9:62225397..62225416 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000032249