Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18617
Trapped Gene
2010100O12Rik (ENSMUSG00000067847)
Vector Insertion
Chr 2: 155971337 - 155971520
Public Clones CMHD-GT_466E9-3 (cmhd)
Private Clones OST419526 (lexicon) OST307135 (lexicon) OST120961 (lexicon) OST120941 (lexicon)
OST120938 (lexicon) OST120937 (lexicon) OST120930 (lexicon) OST120892 (lexicon)
OST120878 (lexicon) OST120873 (lexicon) OST120872 (lexicon) OST120858 (lexicon)
OST120850 (lexicon) OST120842 (lexicon) OST120837 (lexicon) OST120833 (lexicon)
OST120826 (lexicon) OST120817 (lexicon) OST120803 (lexicon) OST106785 (lexicon)
OST65934 (lexicon) OST44976 (lexicon) OST35279 (lexicon)
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680879 (Chr2:155971338..155971529 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGATGCCCTGCAATACCTAA Chr2:155971456..155971475 59.92 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680879 (Chr2:155971338..155971529 +)
Downstram Exon
ENSMUSE00000553460 (Chr2:155971338..155971519 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGATGCCCTGCAATACCTAA Chr2:155971456..155971475 59.92 50 TTAGGTATTGCAGGGCATCC Chr2:155971478..155971497 59.92 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680878 Chr2:155969969..155970325 ATTCGGAGTGAGACGTCGAG Chr2:155969972..155969991 60.41 55
upstream ENSMUSE00000680877 Chr2:155969973..155970021 GAGTGAGACGTCGAGCTGAG Chr2:155969977..155969996 58.86 60
upstream ENSMUSE00000712669 Chr2:155969976..155970016 GAGTGAGACGTCGAGCTGAG Chr2:155969977..155969996 58.86 60
upstream ENSMUSE00000680881 Chr2:155969980..155970016 No primer for this exon
upstream ENSMUSE00000719558 Chr2:155970181..155970325 GGCACCTTCTCCTGTCTCAG Chr2:155970306..155970325 59.99 60
upstream ENSMUSE00000553461 Chr2:155970195..155970325 GGCACCTTCTCCTGTCTCAG Chr2:155970306..155970325 59.99 60
upstream ENSMUSE00000712760 Chr2:155970195..155970325 GGCACCTTCTCCTGTCTCAG Chr2:155970306..155970325 59.99 60

*** Putative Vector Insertion (Chr 2: 155971337 - 155971520) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000553460 Chr2:155971338..155971519 TTAGGTATTGCAGGGCATCC Chr2:155971478..155971497 59.92 50
downstream ENSMUSE00000680879 Chr2:155971338..155971529 TTAGGTATTGCAGGGCATCC Chr2:155971478..155971497 59.92 50
downstream ENSMUSE00000706115 Chr2:155971338..155971530 TTAGGTATTGCAGGGCATCC Chr2:155971478..155971497 59.92 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCAAATTGCTTTCTTGGT Chr2:155971308..155971328 59.55 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCCAAATTGCTTTCTTGGT Chr2:155971308..155971328 59.55 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067847