Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18634
Trapped Gene
Dnalc4 (ENSMUSG00000022420)
Vector Insertion
Chr 15: 79592956 - 79593939
Public Clones not available
Private Clones OST418904 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000126372 (Chr15:79593940..79594023 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGACCATGGAGCTGTGTGTC Chr15:79593973..79593992 58.67 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000126372 (Chr15:79593940..79594023 -)
Downstram Exon
ENSMUSE00000431373 (Chr15:79592857..79592955 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGACCATGGAGCTGTGTGTC Chr15:79593973..79593992 58.67 55 CTCGTGGGTGATCTCAAACC Chr15:79592835..79592854 60.51 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000126368 Chr15:79604789..79604887 TTCCGTGATGGTTGCTAAGA Chr15:79604865..79604884 59.27 45
upstream ENSMUSE00000259610 Chr15:79595246..79595451 TTTTCTGCTCCTGCCAAGTT Chr15:79595413..79595432 59.99 45
upstream ENSMUSE00000126372 Chr15:79593940..79594023 AGACCATGGAGCTGTGTGTC Chr15:79593973..79593992 58.67 55

*** Putative Vector Insertion (Chr 15: 79592956 - 79593939) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000431373 Chr15:79592857..79592955 CTCGTGGGTGATCTCAAACC Chr15:79592835..79592854 60.51 55
downstream ENSMUSE00000431366 Chr15:79592312..79592479 TGATTCCACATGGCCACTAA Chr15:79592384..79592403 59.92 45
downstream ENSMUSE00000126374 Chr15:79591893..79592955 TGATTCCACATGGCCACTAA Chr15:79592384..79592403 59.92 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGGTATTGGCATCAGTGC Chr15:79593922..79593942 59.68 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGGTATTGGCATCAGTGC Chr15:79593922..79593942 59.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022420