Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18637
Trapped Gene
Pdlim7 (ENSMUSG00000021493)
Vector Insertion
Chr 13: 55610172 - 55610252
Public Clones not available
Private Clones OST418882 (lexicon) OST392009 (lexicon)
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000641736 (Chr13:55610253..55610404 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000641736 (Chr13:55610253..55610404 -)
Downstram Exon
ENSMUSE00000641732 (Chr13:55610141..55610171 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000357893 Chr13:55614728..55614799 No primer for this exon
upstream ENSMUSE00000403695 Chr13:55614728..55614795 No primer for this exon
upstream ENSMUSE00000641739 Chr13:55613673..55613779 No primer for this exon
upstream ENSMUSE00000641736 Chr13:55610253..55610404 No primer for this exon

*** Putative Vector Insertion (Chr 13: 55610172 - 55610252) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000641732 Chr13:55610141..55610171 No primer for this exon
downstream ENSMUSE00000641731 Chr13:55609569..55609687 No primer for this exon
downstream ENSMUSE00000641726 Chr13:55609225..55609241 No primer for this exon
downstream ENSMUSE00000682078 Chr13:55609225..55609241 No primer for this exon
downstream ENSMUSE00000641730 Chr13:55608849..55608985 No primer for this exon
downstream ENSMUSE00000682076 Chr13:55608849..55608985 No primer for this exon
downstream ENSMUSE00000641729 Chr13:55608691..55608727 No primer for this exon
downstream ENSMUSE00000682075 Chr13:55608691..55608727 No primer for this exon
downstream ENSMUSE00000641725 Chr13:55608388..55608484 No primer for this exon
downstream ENSMUSE00000682079 Chr13:55608134..55608484 No primer for this exon
downstream ENSMUSE00000413762 Chr13:55607667..55607728 No primer for this exon
downstream ENSMUSE00000682074 Chr13:55607667..55607728 No primer for this exon
downstream ENSMUSE00000359763 Chr13:55607295..55607529 No primer for this exon
downstream ENSMUSE00000682073 Chr13:55607295..55607529 No primer for this exon
downstream ENSMUSE00000232424 Chr13:55606019..55606199 No primer for this exon
downstream ENSMUSE00000682072 Chr13:55606019..55606199 No primer for this exon
downstream ENSMUSE00000232418 Chr13:55600462..55600582 No primer for this exon
downstream ENSMUSE00000682071 Chr13:55600462..55600582 No primer for this exon
downstream ENSMUSE00000232413 Chr13:55600255..55600370 No primer for this exon
downstream ENSMUSE00000682070 Chr13:55600255..55600370 No primer for this exon
downstream ENSMUSE00000392106 Chr13:55599777..55600095 No primer for this exon
downstream ENSMUSE00000682069 Chr13:55599777..55600095 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGTGGATAGCCTCTGGTC Chr13:55610207..55610227 59.53 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGTGGATAGCCTCTGGTC Chr13:55610207..55610227 59.53 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021493