Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18641
Trapped Gene
Ddx59 (ENSMUSG00000026404)
Vector Insertion
Chr 1: 138312001 - 138313158
Public Clones IST14647D9 (tigm) IST10110G4 (tigm) IST14698E6 (tigm) IST12838E10 (tigm)
IST11633E4 (tigm) IST14514B2 (tigm) IST14949C9 (tigm) IST14987F10 (tigm)
IST14452G8 (tigm) IST14446F1 (tigm) IST14742A3 (tigm)
Private Clones OST418849 (lexicon) OST53744 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000234159 (Chr1:138311848..138312000 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000234159 (Chr1:138311848..138312000 +)
Downstram Exon
ENSMUSE00000234151 (Chr1:138313159..138313973 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGTCCTTCACACCCTCATCA Chr1:138313422..138313441 60.09 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000234159 Chr1:138311848..138312000 No primer for this exon

*** Putative Vector Insertion (Chr 1: 138312001 - 138313158) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000234151 Chr1:138313159..138313973 TGTCCTTCACACCCTCATCA Chr1:138313422..138313441 60.09 50
downstream ENSMUSE00000158758 Chr1:138315987..138316154 AGGTAAGCCCCCTACGAGAA Chr1:138316118..138316137 60.09 55
downstream ENSMUSE00000234138 Chr1:138321372..138321461 AGTCGTCCAGGGGTTGCTAT Chr1:138321400..138321419 60.9 55
downstream ENSMUSE00000234131 Chr1:138328889..138329140 TGTGTTCCAAAACGTCAAGC Chr1:138328949..138328968 59.74 45
downstream ENSMUSE00000234123 Chr1:138330290..138330442 ATCTGCGCCTAGTTTGCAGT Chr1:138330352..138330371 60.04 50
downstream ENSMUSE00000234115 Chr1:138331083..138331211 TGCTCACCACGACCTCATAG Chr1:138331122..138331141 59.85 55
downstream ENSMUSE00000234109 Chr1:138336330..138336728 TCCATTTTGACCGAGTCTCC Chr1:138336365..138336384 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000026404