Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18655
Trapped Gene
Rit2 (ENSMUSG00000057455)
Vector Insertion
Chr 18: 31313551 - 31372311
Public Clones not available
Private Clones OST418651 (lexicon) OST154843 (lexicon)
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000140328 (Chr18:31372312..31372385 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAACCCAGGTGAGGATTGA Chr18:31372355..31372374 59.38 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000140328 (Chr18:31372312..31372385 -)
Downstram Exon
ENSMUSE00000471880 (Chr18:31313359..31313550 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAACCCAGGTGAGGATTGA Chr18:31372355..31372374 59.38 45 GTGTGACGGACCTGGAAAAT Chr18:31313395..31313414 59.83 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000479250 Chr18:31476495..31476620 GCGGGTCCAGAGAGTACAAG Chr18:31476532..31476551 59.87 60
upstream ENSMUSE00000487874 Chr18:31402775..31402831 GGACTATCACGACCCCACAA Chr18:31402778..31402797 60.78 55
upstream ENSMUSE00000140328 Chr18:31372312..31372385 AAAACCCAGGTGAGGATTGA Chr18:31372355..31372374 59.38 45

*** Putative Vector Insertion (Chr 18: 31313551 - 31372311) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000471880 Chr18:31313359..31313550 GTGTGACGGACCTGGAAAAT Chr18:31313395..31313414 59.83 50
downstream ENSMUSE00000625601 Chr18:31132777..31135158 GATTCATTGAGAGGGGCAAA Chr18:31134146..31134165 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACATCTTGGACACTGCTGGT Chr18:31348313..31348334 60.17 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACATCTTGGACACTGCTGGT Chr18:31348313..31348334 60.17 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057455