Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18669
Trapped Gene
Zfp472 (ENSMUSG00000053600)
Vector Insertion
Chr 17: 33112986 - 33113171
Public Clones not available
Private Clones OST418496 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000547132 (Chr17:33112859..33112985 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCCAGTGACCTTTGAGGA Chr17:33112859..33112878 60.39 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000547132 (Chr17:33112859..33112985 +)
Downstram Exon
ENSMUSE00000308419 (Chr17:33113172..33113229 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCCAGTGACCTTTGAGGA Chr17:33112859..33112878 60.39 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657707 Chr17:33102854..33102874 TGCATCAGAAGCAGGAAATG Chr17:33102855..33102874 59.95 45
upstream ENSMUSE00000547132 Chr17:33112859..33112985 GAGCCAGTGACCTTTGAGGA Chr17:33112859..33112878 60.39 55

*** Putative Vector Insertion (Chr 17: 33112986 - 33113171) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000308419 Chr17:33113172..33113229 No primer for this exon
downstream ENSMUSE00000500097 Chr17:33114104..33116156 CAGACACAGGGCTTCTCTCC Chr17:33114916..33114935 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTAATCGCCTTGCAGCAC Chr17:33113034..33113054 61.26 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTTCGTGACTGGGAAAACC Chr17:33113033..33113053 59.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053600