Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18671
Trapped Gene
Asb16 (ENSMUSG00000034768)
Vector Insertion
Chr 11: 102134069 - 102137692
Public Clones not available
Private Clones OST418445 (lexicon)
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000236716 (Chr11:102133801..102134068 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGACGGCACCTCTTACCAT Chr11:102133830..102133849 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000236716 (Chr11:102133801..102134068 +)
Downstram Exon
ENSMUSE00000236710 (Chr11:102137693..102138185 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGACGGCACCTCTTACCAT Chr11:102133830..102133849 60.13 55 GCACCGTTCTGCAGGTAGAG Chr11:102137827..102137846 61 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000363772 Chr11:102130057..102130437 TGGGACAAGGAACGATTCTC Chr11:102130081..102130100 60.05 50
upstream ENSMUSE00000236716 Chr11:102133801..102134068 CAGACGGCACCTCTTACCAT Chr11:102133830..102133849 60.13 55

*** Putative Vector Insertion (Chr 11: 102134069 - 102137692) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000236710 Chr11:102137693..102138185 GCACCGTTCTGCAGGTAGAG Chr11:102137827..102137846 61 60
downstream ENSMUSE00000236700 Chr11:102138492..102138605 GATGGAACACATGGGTAGGC Chr11:102138565..102138584 60.2 55
downstream ENSMUSE00000585829 Chr11:102139190..102140776 AAGTTCAGCGCTCACTGGAT Chr11:102139389..102139408 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACATCTCCGGAGTCTTTGC Chr11:102137049..102137069 60.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATCTCCGGAGTCTTTGCAG Chr11:102134051..102134071 60.93 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034768