Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18681
Trapped Gene
Lix1 (ENSMUSG00000047786)
Vector Insertion
Chr 17: 17539991 - 17564119
Public Clones IST14839E10 (tigm) IST13067H10 (tigm) IST12277F7 (tigm) IST12710A11 (tigm)
Private Clones OST418046 (lexicon) OST371431 (lexicon) OST302697 (lexicon) OST279556 (lexicon)
OST262711 (lexicon) OST180643 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000358111 (Chr17:17539650..17539990 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGCATCAATGAGCTGCAC Chr17:17539817..17539836 60.02 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000358111 (Chr17:17539650..17539990 +)
Downstram Exon
ENSMUSE00000255754 (Chr17:17564120..17564283 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGCATCAATGAGCTGCAC Chr17:17539817..17539836 60.02 50 GAAAGTTGCCAAAGCAGCTC Chr17:17564284..17564303 60.14 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000358111 Chr17:17539650..17539990 ACTGCATCAATGAGCTGCAC Chr17:17539817..17539836 60.02 50

*** Putative Vector Insertion (Chr 17: 17539991 - 17564119) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000255754 Chr17:17564120..17564283 GAAAGTTGCCAAAGCAGCTC Chr17:17564284..17564303 60.14 50
downstream ENSMUSE00000391086 Chr17:17580612..17580752 CTGGTGGAGGCTACTGCTTC Chr17:17580754..17580773 60.01 60
downstream ENSMUSE00000346882 Chr17:17582932..17583027 CATCCGCATCATCTAACGTG Chr17:17582956..17582975 60.1 50
downstream ENSMUSE00000658211 Chr17:17586000..17586101 AGGACTGGCCCACAGAAAAT Chr17:17586032..17586051 60.88 50
downstream ENSMUSE00000555243 Chr17:17591224..17591301 CGAGAGCACTTTGTTTCACG Chr17:17591300..17591319 59.63 50
downstream ENSMUSE00000658210 Chr17:17594070..17596349 GTGGACATTGCCAAACACAG Chr17:17595395..17595414 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCATAATCGCCTTGCAGCAC Chr17:17543039..17543059 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCACGTGACTGGGAAAACC Chr17:17543038..17543058 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047786