Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18688
Trapped Gene
B4galnt2 (ENSMUSG00000013418)
Vector Insertion
Chr 11: 95735263 - 95737411
Public Clones (cmhd)
Private Clones OST417733 (lexicon)
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000110895 (Chr11:95737412..95737592 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000110895 (Chr11:95737412..95737592 -)
Downstram Exon
ENSMUSE00000110893 (Chr11:95735176..95735262 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661431 Chr11:95776134..95776185 No primer for this exon
upstream ENSMUSE00000674177 Chr11:95753658..95753668 No primer for this exon
upstream ENSMUSE00000661430 Chr11:95753072..95753287 No primer for this exon
upstream ENSMUSE00000674180 Chr11:95752287..95752424 No primer for this exon
upstream ENSMUSE00000291477 Chr11:95750121..95750227 No primer for this exon
upstream ENSMUSE00000291471 Chr11:95745257..95745294 No primer for this exon
upstream ENSMUSE00000110895 Chr11:95737412..95737592 No primer for this exon

*** Putative Vector Insertion (Chr 11: 95735263 - 95737411) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000110893 Chr11:95735176..95735262 No primer for this exon
downstream ENSMUSE00000110898 Chr11:95730548..95730735 No primer for this exon
downstream ENSMUSE00000110894 Chr11:95729664..95729804 No primer for this exon
downstream ENSMUSE00000110896 Chr11:95728064..95728283 No primer for this exon
downstream ENSMUSE00000648516 Chr11:95724873..95727590 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACTGCTGGAAAAGAGCATCA Chr11:95737371..95737392 60.01 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACTGCTGGAAAAGAGCATCA Chr11:95737371..95737392 60.01 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCTTCTCTGGGGACACTGAA Chr11:95737559..95737579 60.39 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCTTCTCTGGGGACACTGAA Chr11:95737559..95737579 60.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013418