Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18689
Trapped Gene
2210408I21Rik (ENSMUSG00000071252)
Vector Insertion
Chr 13: 77274892 - 77314113
Public Clones (sanger) D086H02 (ggtc) D086H02 (ggtc)
Private Clones OST417640 (lexicon) OST415981 (lexicon) OST276656 (lexicon) OST249676 (lexicon)
OST230586 (lexicon) OST205216 (lexicon) OST126957 (lexicon) OST115294 (lexicon)
OST111123 (lexicon) OST103577 (lexicon) OST79589 (lexicon) OST68953 (lexicon)
OST57156 (lexicon) OST38793 (lexicon) OST33867 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000119318 (Chr13:77274860..77274891 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000119318 (Chr13:77274860..77274891 +)
Downstram Exon
ENSMUSE00000612592 (Chr13:77314114..77314245 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACTCCAAATCTCCGGGAAAC Chr13:77314196..77314215 60.31 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000119318 Chr13:77274860..77274891 No primer for this exon

*** Putative Vector Insertion (Chr 13: 77274892 - 77314113) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000612592 Chr13:77314114..77314245 ACTCCAAATCTCCGGGAAAC Chr13:77314196..77314215 60.31 50
downstream ENSMUSE00000612591 Chr13:77322862..77323030 TGTGCATCTGGACAGAGCTT Chr13:77322924..77322943 59.58 50
downstream ENSMUSE00000570090 Chr13:77331815..77332484 TGCACGAAGGAAAGGAGTCT Chr13:77332211..77332230 59.99 50
downstream ENSMUSE00000612590 Chr13:77384462..77384623 AGAACTCCTGGGCATCTGAA Chr13:77384622..77384641 59.8 50
downstream ENSMUSE00000612589 Chr13:77393384..77393478 TGCCTCTGGTGGTTTATTGTT Chr13:77393462..77393482 59.49 42.86
downstream ENSMUSE00000612588 Chr13:77399102..77399329 ATGCAGTGTGCTATGGCAAG Chr13:77399172..77399191 59.9 50
downstream ENSMUSE00000612587 Chr13:77401150..77401415 CGCTGAGAGACATACGTTGC Chr13:77401376..77401395 59.62 55
downstream ENSMUSE00000612586 Chr13:77402793..77402943 GAATTCCTGATAGCGCTGGA Chr13:77402835..77402854 60.32 50
downstream ENSMUSE00000612585 Chr13:77406923..77407113 AGCTTAGGGGGCAGTATGGT Chr13:77407014..77407033 59.98 55
downstream ENSMUSE00000612584 Chr13:77409023..77409205 No primer for this exon
downstream ENSMUSE00000612583 Chr13:77420303..77420413 GTGATTCATCGACACCATGC Chr13:77420334..77420353 59.93 50
downstream ENSMUSE00000612582 Chr13:77437728..77437867 GGCTGCGATAAGAGCAGTTT Chr13:77437790..77437809 59.62 50
downstream ENSMUSE00000612579 Chr13:77442557..77442721 CAGGCTACCACCTGCACTCT Chr13:77442606..77442625 60.47 60
downstream ENSMUSE00000612544 Chr13:77455609..77455833 GTCCATCAGTGCCAGTCTCA Chr13:77455673..77455692 59.83 55
downstream ENSMUSE00000612543 Chr13:77462626..77463031 AAGCTGTTGCTCCATCCAGT Chr13:77463005..77463024 59.87 50
downstream ENSMUSE00000612542 Chr13:77467128..77467284 GGACCATCGCATTTGTTTTC Chr13:77467216..77467235 60.32 45
downstream ENSMUSE00000612541 Chr13:77471564..77471719 AGGCTGATCTTCATCCCTCA Chr13:77471665..77471684 59.76 50
downstream ENSMUSE00000612540 Chr13:77473530..77473638 ATTTGGCAGCAAGTTTGACC Chr13:77473580..77473599 60.12 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCTTTCCATTCCCCTCAT Chr13:77292855..77292875 58.79 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATCTTTCCATTCCCCTCAT Chr13:77292855..77292875 58.79 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071252