Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1871
Trapped Gene
Sf3a2 (ENSMUSG00000020211)
Vector Insertion
Chr 10: 80264273 - 80265142
Public Clones AZ0169 (sanger)
Private Clones OST401834 (lexicon) OST220407 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000101853 (Chr10:80264201..80264272 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000101853 (Chr10:80264201..80264272 +)
Downstram Exon
ENSMUSE00000101850 (Chr10:80265143..80265189 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000516865 Chr10:80261329..80261550 No primer for this exon
upstream ENSMUSE00000360387 Chr10:80263941..80264103 No primer for this exon
upstream ENSMUSE00000101853 Chr10:80264201..80264272 No primer for this exon

*** Putative Vector Insertion (Chr 10: 80264273 - 80265142) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000101850 Chr10:80265143..80265189 No primer for this exon
downstream ENSMUSE00000101868 Chr10:80265537..80265646 No primer for this exon
downstream ENSMUSE00000101873 Chr10:80266205..80266254 No primer for this exon
downstream ENSMUSE00000101862 Chr10:80266328..80266468 No primer for this exon
downstream ENSMUSE00000574715 Chr10:80266565..80266603 No primer for this exon
downstream ENSMUSE00000574717 Chr10:80266717..80267559 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTATCTGCCCCTGCTTTTT Chr10:80264273..80264293 60.45 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATTCGTGACTGGGAAAACC Chr10:80264320..80264340 60.35 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020211