Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18714
Trapped Gene
Azi2 (ENSMUSG00000039285)
Vector Insertion
Chr 9: 117950077 - 117956530
Public Clones not available
Private Clones OST416499 (lexicon) OST332119 (lexicon) OST82843 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000633738 (Chr9:117949617..117950076 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTACGTAGCCAGGGTTCAG Chr9:117950056..117950075 59.75 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000633738 (Chr9:117949617..117950076 +)
Downstram Exon
ENSMUSE00000364911 (Chr9:117956531..117956751 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTACGTAGCCAGGGTTCAG Chr9:117950056..117950075 59.75 60 AGGGTACGCTGAGAGTGGAG Chr9:117956628..117956647 59.47 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000633738 Chr9:117949617..117950076 CCTACGTAGCCAGGGTTCAG Chr9:117950056..117950075 59.75 60

*** Putative Vector Insertion (Chr 9: 117950077 - 117956530) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000364911 Chr9:117956531..117956751 AGGGTACGCTGAGAGTGGAG Chr9:117956628..117956647 59.47 60
downstream ENSMUSE00000327094 Chr9:117958428..117958553 No primer for this exon
downstream ENSMUSE00000327081 Chr9:117959015..117959114 TGCTGAGTCTCCACCTCTGTT Chr9:117959114..117959134 60.04 52.38
downstream ENSMUSE00000327068 Chr9:117960472..117960620 GAGGTCACTGCACTCCTTCC Chr9:117960593..117960612 59.84 60
downstream ENSMUSE00000327057 Chr9:117964934..117965028 CTCGGCCTGATGACATCTCT Chr9:117964986..117965005 60.37 55
downstream ENSMUSE00000633732 Chr9:117968175..117968293 CTGCTTGCACTTGAGTCACC Chr9:117968254..117968273 59.62 55
downstream ENSMUSE00000382301 Chr9:117970832..117973025 GAGAACTGCACAAGCCATCA Chr9:117971347..117971366 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTAATCGCCTTGCAGCAC Chr9:117956125..117956145 61.9 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGTCGTGACTGGGAAAAC Chr9:117956123..117956143 58.6 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039285