Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18721
Trapped Gene
Spire1 (ENSMUSG00000024533)
Vector Insertion
Chr 18: 67690139 - 67705268
Public Clones not available
Private Clones OST416113 (lexicon)
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000701548 (Chr18:67705269..67705394 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTCACCTCCCAACTGAGTC Chr18:67705366..67705385 59.84 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000701548 (Chr18:67705269..67705394 -)
Downstram Exon
ENSMUSE00000143108 (Chr18:67690061..67690138 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTCACCTCCCAACTGAGTC Chr18:67705366..67705385 59.84 60 AGGTCCTCCAGATCTGTGCT Chr18:67690055..67690074 58.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000572268 Chr18:67770059..67770443 GAGATCCTGCGGCTCTACAA Chr18:67770253..67770272 60.5 55
upstream ENSMUSE00000572267 Chr18:67747479..67747513 No primer for this exon
upstream ENSMUSE00000572256 Chr18:67712228..67712375 CCGGTCCTATCAGGACGTTA Chr18:67712233..67712252 59.95 55
upstream ENSMUSE00000572266 Chr18:67712228..67712461 CCGGTCCTATCAGGACGTTA Chr18:67712233..67712252 59.95 55
upstream ENSMUSE00000701549 Chr18:67708778..67708827 No primer for this exon
upstream ENSMUSE00000457637 Chr18:67705269..67705394 GCTCACCTCCCAACTGAGTC Chr18:67705366..67705385 59.84 60
upstream ENSMUSE00000701548 Chr18:67705269..67705394 GCTCACCTCCCAACTGAGTC Chr18:67705366..67705385 59.84 60

*** Putative Vector Insertion (Chr 18: 67690139 - 67705268) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000143108 Chr18:67690061..67690138 AGGTCCTCCAGATCTGTGCT Chr18:67690055..67690074 58.85 55
downstream ENSMUSE00000143125 Chr18:67688518..67688682 CATTTCGCAAATCCCTCATC Chr18:67688621..67688640 60.41 45
downstream ENSMUSE00000314225 Chr18:67679458..67679544 TGGATTTAAAGGGGGTCTTG Chr18:67679436..67679455 58.88 45
downstream ENSMUSE00000709274 Chr18:67678945..67679074 TCTGGTGACACAGGTCGAAG Chr18:67678946..67678965 59.86 55
downstream ENSMUSE00000721234 Chr18:67678945..67679074 TCTGGTGACACAGGTCGAAG Chr18:67678946..67678965 59.86 55
downstream ENSMUSE00000572255 Chr18:67672495..67672533 CAAGTCAAAACTGTGAGACATGC Chr18:67672477..67672499 59.83 43.48
downstream ENSMUSE00000701545 Chr18:67672495..67672533 CAAGTCAAAACTGTGAGACATGC Chr18:67672477..67672499 59.83 43.48
downstream ENSMUSE00000625262 Chr18:67666208..67666380 TGGAGATTCTGGCGTAGTGA Chr18:67666336..67666355 59.39 50
downstream ENSMUSE00000701544 Chr18:67666208..67666380 TGGAGATTCTGGCGTAGTGA Chr18:67666336..67666355 59.39 50
downstream ENSMUSE00000625261 Chr18:67665305..67665398 GCTGGTTGACTTGTGCAGAC Chr18:67665347..67665366 59.47 55
downstream ENSMUSE00000701543 Chr18:67665305..67665398 GCTGGTTGACTTGTGCAGAC Chr18:67665347..67665366 59.47 55
downstream ENSMUSE00000625260 Chr18:67663085..67663227 GCCTCACGTTCGTAGGTGTT Chr18:67663101..67663120 60.18 55
downstream ENSMUSE00000701540 Chr18:67663085..67663227 GCCTCACGTTCGTAGGTGTT Chr18:67663101..67663120 60.18 55
downstream ENSMUSE00000572261 Chr18:67660722..67660895 CCACCTGCTGGTAAAAGCTC Chr18:67660712..67660731 59.88 55
downstream ENSMUSE00000625259 Chr18:67656831..67656968 AGCTCTGCTTTCACCAGGAC Chr18:67656861..67656880 59.6 55
downstream ENSMUSE00000701539 Chr18:67656831..67656968 AGCTCTGCTTTCACCAGGAC Chr18:67656861..67656880 59.6 55
downstream ENSMUSE00000625258 Chr18:67656216..67656286 GTTCGGCAACAGAAGCAGAG Chr18:67656245..67656264 61.12 55
downstream ENSMUSE00000701538 Chr18:67656216..67656286 GTTCGGCAACAGAAGCAGAG Chr18:67656245..67656264 61.12 55
downstream ENSMUSE00000625257 Chr18:67655017..67655044 No primer for this exon
downstream ENSMUSE00000701536 Chr18:67655017..67655044 No primer for this exon
downstream ENSMUSE00000625256 Chr18:67654794..67654930 ATACTTCGAAGAGGCCGATG Chr18:67654778..67654797 59.29 50
downstream ENSMUSE00000701533 Chr18:67654794..67654930 ATACTTCGAAGAGGCCGATG Chr18:67654778..67654797 59.29 50
downstream ENSMUSE00000659122 Chr18:67647867..67651203 GAAACTGGAGCTCCTCATCG Chr18:67651129..67651148 59.95 55
downstream ENSMUSE00000659123 Chr18:67647863..67651203 GAAACTGGAGCTCCTCATCG Chr18:67651129..67651148 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTCCTCATAATCGCCTTG Chr18:67690206..67690226 59.66 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATATTGCGTGACTGGGAAA Chr18:67693204..67693224 58.09 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024533