Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18726
Trapped Gene
Mrpl28 (ENSMUSG00000024181)
Vector Insertion
Chr 17: 26260795 - 26261500
Public Clones not available
Private Clones OST415917 (lexicon) OST33871 (lexicon)
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000253936 (Chr17:26260480..26260794 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTTGAGGACGTACCCATTC Chr17:26260689..26260708 60.38 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000253936 (Chr17:26260480..26260794 +)
Downstram Exon
ENSMUSE00000139204 (Chr17:26261501..26261653 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTTGAGGACGTACCCATTC Chr17:26260689..26260708 60.38 55 CACGGTGAACTTCTTGTCCA Chr17:26261590..26261609 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000253936 Chr17:26260480..26260794 CGTTGAGGACGTACCCATTC Chr17:26260689..26260708 60.38 55

*** Putative Vector Insertion (Chr 17: 26260795 - 26261500) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000139204 Chr17:26261501..26261653 CACGGTGAACTTCTTGTCCA Chr17:26261590..26261609 59.72 50
downstream ENSMUSE00000253876 Chr17:26262202..26262336 TTCAGGTCCATGCCAAACTT Chr17:26262248..26262267 60.49 45
downstream ENSMUSE00000139205 Chr17:26262423..26262509 TCCTCCAGAAGCCTCTGTTT Chr17:26262508..26262527 59.01 50
downstream ENSMUSE00000139206 Chr17:26263216..26263556 AAGGACTTGACCAGCTTGGA Chr17:26263487..26263506 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGATACGCCAACAACGACA Chr17:26260774..26260794 60.72 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGATACGCCAACAACGACA Chr17:26260774..26260794 60.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024181