Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18740
Trapped Gene
Bcar1 (ENSMUSG00000031955)
Vector Insertion
Chr 8: 114235295 - 114236500
Public Clones not available
Private Clones OST415477 (lexicon)
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214938 (Chr8:114236501..114236590 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGCTGCTAGAAAGGGGTAA Chr8:114236541..114236561 59.86 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214938 (Chr8:114236501..114236590 -)
Downstram Exon
ENSMUSE00000214937 (Chr8:114234385..114235294 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGCTGCTAGAAAGGGGTAA Chr8:114236541..114236561 59.86 52.38 ATTGGACGAGACACCTCCTG Chr8:114235229..114235248 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679154 Chr8:114246997..114247008 No primer for this exon
upstream ENSMUSE00000634293 Chr8:114245273..114245281 No primer for this exon
upstream ENSMUSE00000423144 Chr8:114244599..114245231 TGGTAACCGCCTCAAGATTC Chr8:114245057..114245076 60.07 50
upstream ENSMUSE00000214942 Chr8:114239515..114239676 CCTAACCAGTATGGCCAGGA Chr8:114239516..114239535 59.95 55
upstream ENSMUSE00000214941 Chr8:114239183..114239299 TATGACGTGCCCCCTAGTGT Chr8:114239217..114239236 60.4 55
upstream ENSMUSE00000214936 Chr8:114237239..114238336 AAGCTTAGCCGGCAACTACA Chr8:114237612..114237631 60.04 50
upstream ENSMUSE00000214938 Chr8:114236501..114236590 GGAGCTGCTAGAAAGGGGTAA Chr8:114236541..114236561 59.86 52.38

*** Putative Vector Insertion (Chr 8: 114235295 - 114236500) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214937 Chr8:114234385..114235294 ATTGGACGAGACACCTCCTG Chr8:114235229..114235248 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTAATCGCCTTGCAGCAC Chr8:114236432..114236452 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGGATAGAGCGTGACTGG Chr8:114236440..114236460 60.81 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031955