Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18742
Trapped Gene
Aurkc (ENSMUSG00000070837)
Vector Insertion
Chr 7: 6949013 - 6949229
Public Clones not available
Private Clones OST415470 (lexicon) OST283516 (lexicon) OST276777 (lexicon) OST112301 (lexicon)
OST54704 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000677184 (Chr7:6948979..6949012 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000677184 (Chr7:6948979..6949012 +)
Downstram Exon
ENSMUSE00000600447 (Chr7:6949230..6949421 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GTGTGCCTGGATCTCCACTT Chr7:6949419..6949438 60.12 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000600456 Chr7:6948154..6948259 GCTGGGATCTACGAGACTGC Chr7:6948164..6948183 59.98 60
upstream ENSMUSE00000677184 Chr7:6948979..6949012 No primer for this exon

*** Putative Vector Insertion (Chr 7: 6949013 - 6949229) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000600447 Chr7:6949230..6949421 GTGTGCCTGGATCTCCACTT Chr7:6949419..6949438 60.12 55
downstream ENSMUSE00000600452 Chr7:6950225..6950363 GTACGCTGCTGGTCCAACTT Chr7:6950359..6950378 60.32 55
downstream ENSMUSE00000600444 Chr7:6952690..6952838 GGTCAGGGCATCTGACAACT Chr7:6952722..6952741 60.12 55
downstream ENSMUSE00000537783 Chr7:6955068..6955242 CGGTTTCTGCGCTATCATTT Chr7:6955131..6955150 60.23 45
downstream ENSMUSE00000537808 Chr7:6955504..6955799 CCTTCGAGAGTGTTCCCTGA Chr7:6955644..6955663 60.38 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr7:6949063..6949083 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGACGTGACTGGGAAAAC Chr7:6949059..6949079 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070837