Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18751
Trapped Gene
Kcnh2 (ENSMUSG00000038319)
Vector Insertion
Chr 5: 23825968 - 23827062
Public Clones not available
Private Clones OST415081 (lexicon) OST376848 (lexicon)
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000263576 (Chr5:23827063..23827240 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCCTACAGTGCTGTGACC Chr5:23827147..23827166 59.49 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000263576 (Chr5:23827063..23827240 -)
Downstram Exon
ENSMUSE00000411292 (Chr5:23825408..23825967 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCCTACAGTGCTGTGACC Chr5:23827147..23827166 59.49 60 AGGTGCTTCTGCACAGGTCT Chr5:23825690..23825709 60.06 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000263646 Chr5:23857026..23857422 CACTAAGCAGAGCGGGAATC Chr5:23857253..23857272 59.98 55
upstream ENSMUSE00000263641 Chr5:23854129..23854359 CGCAAGTTCATCATCGCTAA Chr5:23854338..23854357 59.98 45
upstream ENSMUSE00000263638 Chr5:23838710..23838874 CTCATGACACCAACCACAGG Chr5:23838738..23838757 60 55
upstream ENSMUSE00000263630 Chr5:23837481..23837930 GGTCTGCTTCACCAGTAGCC Chr5:23837671..23837690 59.87 60
upstream ENSMUSE00000263621 Chr5:23836729..23836940 GATAAAAGAGCGGACCCACA Chr5:23836752..23836771 60.07 50
upstream ENSMUSE00000701676 Chr5:23834983..23835090 No primer for this exon
upstream ENSMUSE00000263617 Chr5:23832167..23832595 CGCATTGCTGTGCACTACTT Chr5:23832243..23832262 60.08 50
upstream ENSMUSE00000263613 Chr5:23831312..23831699 GGAACAGCCTCACATGGACT Chr5:23831516..23831535 60.12 55
upstream ENSMUSE00000602600 Chr5:23830774..23830973 AGCATGCTTGGTCCTACACC Chr5:23830795..23830814 60.14 55
upstream ENSMUSE00000263602 Chr5:23830151..23830403 GGACCTGCTTACTGCCCTCT Chr5:23830211..23830230 60.79 60
upstream ENSMUSE00000263596 Chr5:23828889..23829082 TATATGCCCGTCCTGGAAAG Chr5:23829030..23829049 59.92 50
upstream ENSMUSE00000263589 Chr5:23828473..23828572 No primer for this exon
upstream ENSMUSE00000263584 Chr5:23827764..23828039 GAGCCTTTGACAGAGGATGG Chr5:23827796..23827815 59.8 55
upstream ENSMUSE00000263581 Chr5:23827454..23827640 GTACCAGGAGTTGCCTCGAT Chr5:23827563..23827582 59.17 55
upstream ENSMUSE00000263576 Chr5:23827063..23827240 CTGCCTACAGTGCTGTGACC Chr5:23827147..23827166 59.49 60

*** Putative Vector Insertion (Chr 5: 23825968 - 23827062) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000411292 Chr5:23825408..23825967 AGGTGCTTCTGCACAGGTCT Chr5:23825690..23825709 60.06 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr5:23826992..23827012 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGACTCGCTTTCTCAGGTA Chr5:23827058..23827078 58.6 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038319