Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18756
Trapped Gene
Yes1 (ENSMUSG00000014932)
Vector Insertion
Chr 5: 32955680 - 32957478
Public Clones not available
Private Clones OST415017 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000481204 (Chr5:32955530..32955679 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000481204 (Chr5:32955530..32955679 +)
Downstram Exon
ENSMUSE00000548912 (Chr5:32957479..32957634 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000489020 Chr5:32913606..32914210 No primer for this exon
upstream ENSMUSE00000185983 Chr5:32942704..32942976 No primer for this exon
upstream ENSMUSE00000185982 Chr5:32947381..32947480 No primer for this exon
upstream ENSMUSE00000185987 Chr5:32954030..32954128 No primer for this exon
upstream ENSMUSE00000185993 Chr5:32955336..32955439 No primer for this exon
upstream ENSMUSE00000481204 Chr5:32955530..32955679 No primer for this exon

*** Putative Vector Insertion (Chr 5: 32955680 - 32957478) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000548912 Chr5:32957479..32957634 No primer for this exon
downstream ENSMUSE00000548910 Chr5:32957801..32957980 No primer for this exon
downstream ENSMUSE00000247158 Chr5:32961408..32961484 No primer for this exon
downstream ENSMUSE00000185985 Chr5:32963125..32963278 No primer for this exon
downstream ENSMUSE00000506912 Chr5:32966642..32966773 No primer for this exon
downstream ENSMUSE00000508955 Chr5:32986924..32989430 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTTCGTGTAATCGCCTTG Chr5:32955722..32955742 59.73 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTCATGTTCTGTTTCGTG Chr5:32955711..32955731 59.13 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014932