Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18774
Trapped Gene
Stag2 (ENSMUSG00000025862)
Vector Insertion
Chr X: 39504012 - 39555031
Public Clones (sanger) IST11038E5 (tigm)
Private Clones OST414524 (lexicon) OST345597 (lexicon) OST316653 (lexicon) OST235423 (lexicon)
OST101319 (lexicon) OST59809 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000701611 (ChrX:39503878..39504011 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTGGCATCGATCTCTCCAT ChrX:39503970..39503989 60.04 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000701611 (ChrX:39503878..39504011 +)
Downstram Exon
ENSMUSE00000328276 (ChrX:39555032..39555171 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTGGCATCGATCTCTCCAT ChrX:39503970..39503989 60.04 50 CTTCTGGATCACCCCAATGT ChrX:39555119..39555138 59.78 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000701656 ChrX:39502589..39502862 GCTTCCGTCCCTCAGTAGAA ChrX:39502705..39502724 59.43 55
upstream ENSMUSE00000701611 ChrX:39503878..39504011 GTTGGCATCGATCTCTCCAT ChrX:39503970..39503989 60.04 50

*** Putative Vector Insertion (Chr X: 39504012 - 39555031) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000328276 ChrX:39555032..39555171 CTTCTGGATCACCCCAATGT ChrX:39555119..39555138 59.78 50
downstream ENSMUSE00000328268 ChrX:39559223..39559301 CCTTTGCCTTGCTTCTGATT ChrX:39559300..39559319 59.45 45
downstream ENSMUSE00000442132 ChrX:39564255..39564419 GATGACCGTTCATTCGGTTT ChrX:39564354..39564373 59.8 45
downstream ENSMUSE00000153687 ChrX:39570512..39570608 CCGGTCATGCTTGTAGGACT ChrX:39570556..39570575 60.13 55
downstream ENSMUSE00000153668 ChrX:39574155..39574231 No primer for this exon
downstream ENSMUSE00000555738 ChrX:39576423..39576627 CAGGGTGCTTGTATGTCGAA ChrX:39576626..39576645 59.72 50
downstream ENSMUSE00000555737 ChrX:39578105..39578256 TCCGTTCTGCCTCGTACTGT ChrX:39578197..39578216 60.85 55
downstream ENSMUSE00000555735 ChrX:39579966..39580039 No primer for this exon
downstream ENSMUSE00000153674 ChrX:39581388..39581511 TCCAAATGCCAATCTCTTCA ChrX:39581443..39581462 59.2 40
downstream ENSMUSE00000153673 ChrX:39582301..39582399 No primer for this exon
downstream ENSMUSE00000153679 ChrX:39582496..39582575 No primer for this exon
downstream ENSMUSE00000328202 ChrX:39587048..39587155 TCTCCAGCTGCAACTGCTAC ChrX:39587143..39587162 59.34 55
downstream ENSMUSE00000153677 ChrX:39587823..39587934 TTCTTTTCATCAGCCCATCC ChrX:39587872..39587891 60.01 45
downstream ENSMUSE00000555727 ChrX:39589466..39589583 AAGGTAAGCTGCATGCTCGT ChrX:39589492..39589511 60.04 50
downstream ENSMUSE00000411112 ChrX:39590128..39590231 CACGGGAGGATGACATTCAG ChrX:39590213..39590232 61.49 55
downstream ENSMUSE00000392880 ChrX:39600143..39600235 CCACAGCAAACAGCTCAGTG ChrX:39600215..39600234 60.65 55
downstream ENSMUSE00000153666 ChrX:39600356..39600445 TGCAACAAATTGGTCACCTT ChrX:39600396..39600415 59.02 40
downstream ENSMUSE00000153680 ChrX:39601027..39601230 CGCAATAAGGCATCCAAATG ChrX:39601049..39601068 61.34 45
downstream ENSMUSE00000153669 ChrX:39603182..39603252 TGCGTCATCTTCATCAGGTT ChrX:39603211..39603230 59.24 45
downstream ENSMUSE00000555719 ChrX:39603509..39603596 TTTCGATTCCGGTTTTCAAG ChrX:39603579..39603598 60.05 40
downstream ENSMUSE00000153665 ChrX:39603698..39603778 TAGCAAGCTGCCAAAGGATT ChrX:39603755..39603774 59.98 45
downstream ENSMUSE00000153667 ChrX:39606231..39606323 No primer for this exon
downstream ENSMUSE00000153672 ChrX:39606854..39607028 GTCACGCCCTCCAGACATAA ChrX:39606922..39606941 61.07 55
downstream ENSMUSE00000153663 ChrX:39610032..39610171 TGTTCATCTCCACCACGGTA ChrX:39610142..39610161 59.96 50
downstream ENSMUSE00000555712 ChrX:39611203..39611304 TGAATTTTGTCAATCTGCCTTG ChrX:39611271..39611292 60.11 36.36
downstream ENSMUSE00000153671 ChrX:39612532..39612680 ACGCCGAGCAAGTTCTTTTA ChrX:39612621..39612640 60.02 45
downstream ENSMUSE00000153681 ChrX:39613781..39613909 TCCTGTCGGAGCAGTTTAGAA ChrX:39613899..39613919 60 47.62
downstream ENSMUSE00000153675 ChrX:39615836..39616059 CGTACAGTTGATCCCCGACT ChrX:39615997..39616016 59.99 55
downstream ENSMUSE00000153685 ChrX:39619263..39619452 AGAGGCGTTTGATGGTGTTC ChrX:39619446..39619465 60.12 50
downstream ENSMUSE00000701623 ChrX:39619543..39619653 AGCTCATTGCTGCTCTCTCC ChrX:39619622..39619641 59.86 55
downstream ENSMUSE00000153661 ChrX:39622558..39622684 TGTCAAAGTCCATTCCCTCA ChrX:39622670..39622689 59.06 45
downstream ENSMUSE00000328097 ChrX:39624422..39624499 TCAAAGAAATCGGGCTTCAG ChrX:39624477..39624496 60.32 45
downstream ENSMUSE00000328090 ChrX:39628440..39630352 CCTAAGCCTCGCAAAATGAG ChrX:39629752..39629771 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTCCCAGAGTCCAAGGTA ChrX:39504021..39504041 60.79 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTCCCAGAGTCCAAGGTA ChrX:39504021..39504041 60.79 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025862