Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18777
Trapped Gene
Tgif1 (ENSMUSG00000047407)
Vector Insertion
Chr 17: 71193551 - 71194613
Public Clones not available
Private Clones OST414491 (lexicon) OST316074 (lexicon) OST209660 (lexicon) OST184586 (lexicon)
OST139103 (lexicon)
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000714388 (Chr17:71193554..71194612 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCAGACCTCAACCAGGAT Chr17:71194118..71194137 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000714388 (Chr17:71193554..71194612 -)
Downstram Exon
ENSMUSE00000606361 (Chr17:71193552..71194612 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCAGACCTCAACCAGGAT Chr17:71194118..71194137 59.96 55 ATCCTGGTTGAGGTCTGGTG Chr17:71194096..71194115 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710962 Chr17:71202788..71202886 CGCTCCGACTTCTTAACTGC Chr17:71202852..71202871 60.15 55
upstream ENSMUSE00000718089 Chr17:71200650..71201074 AAGGATGGGGGTGTCTTTTC Chr17:71200894..71200913 60.17 50
upstream ENSMUSE00000692627 Chr17:71200212..71200550 TCCTAGAAACCCCAGCTTCA Chr17:71200254..71200273 59.81 50
upstream ENSMUSE00000606362 Chr17:71195512..71195738 TCTGCGAGACTGGCTGTATG Chr17:71195589..71195608 60.16 55
upstream ENSMUSE00000716636 Chr17:71195512..71195738 TCTGCGAGACTGGCTGTATG Chr17:71195589..71195608 60.16 55
upstream ENSMUSE00000714388 Chr17:71193554..71194612 CACCAGACCTCAACCAGGAT Chr17:71194118..71194137 59.96 55
upstream ENSMUSE00000606361 Chr17:71193552..71194612 CACCAGACCTCAACCAGGAT Chr17:71194118..71194137 59.96 55
upstream ENSMUSE00000717035 Chr17:71193551..71194612 CACCAGACCTCAACCAGGAT Chr17:71194118..71194137 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCCTGACATGCCGTGACT Chr17:71194555..71194575 61.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047407