Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18811
Trapped Gene
Ccdc66 (ENSMUSG00000046753)
Vector Insertion
Chr 14: 28299648 - 28300137
Public Clones not available
Private Clones OST413772 (lexicon)
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000518160 (Chr14:28299790..28300136 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTCAATGATGCGCTACCAC Chr14:28300098..28300117 59.69 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000518160 (Chr14:28299790..28300136 -)
Downstram Exon
ENSMUSE00000691071 (Chr14:28299649..28300136 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTCAATGATGCGCTACCAC Chr14:28300098..28300117 59.69 45 AGCGCATCATTGAAAATTCC Chr14:28300081..28300100 60.04 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486388 Chr14:28321608..28321646 No primer for this exon
upstream ENSMUSE00000375970 Chr14:28319837..28319901 No primer for this exon
upstream ENSMUSE00000335585 Chr14:28318824..28318849 No primer for this exon
upstream ENSMUSE00000360786 Chr14:28313427..28313868 AGTGTGAACCAGGGAAATGG Chr14:28313465..28313484 59.82 50
upstream ENSMUSE00000351706 Chr14:28311910..28312075 CAGCCAAAGGATGTGAATGA Chr14:28312021..28312040 59.65 45
upstream ENSMUSE00000460896 Chr14:28311627..28311730 TGAATGGAAACCAGCTGACA Chr14:28311705..28311724 60.24 45
upstream ENSMUSE00000463928 Chr14:28310525..28310637 CCCTTGGAAGCCATCTGATA Chr14:28310563..28310582 60.03 50
upstream ENSMUSE00000462912 Chr14:28307267..28307398 GGAGCAGCAGAGAAAATGGA Chr14:28307338..28307357 60.48 50
upstream ENSMUSE00000465970 Chr14:28306458..28306708 TATCACACGGTCCGAAAACA Chr14:28306460..28306479 59.96 45
upstream ENSMUSE00000410901 Chr14:28306205..28306289 CGCCGACAAAAACAATTAGA Chr14:28306212..28306231 58.82 40
upstream ENSMUSE00000376883 Chr14:28304974..28305135 GGTAGAAGAGAACCGCAGGA Chr14:28305099..28305118 59.43 55
upstream ENSMUSE00000331432 Chr14:28303849..28303993 GAACTGGCTCAGAAGGGACA Chr14:28303881..28303900 60.39 55
upstream ENSMUSE00000390035 Chr14:28303220..28303330 CAACAGCCTCTCCCAAGAAG Chr14:28303239..28303258 59.98 55
upstream ENSMUSE00000518160 Chr14:28299790..28300136 TTTCAATGATGCGCTACCAC Chr14:28300098..28300117 59.69 45
upstream ENSMUSE00000521136 Chr14:28299680..28299787 AGAGGCATTTCACCACTTGC Chr14:28299701..28299720 60.26 50
upstream ENSMUSE00000691071 Chr14:28299649..28300136 TTTCAATGATGCGCTACCAC Chr14:28300098..28300117 59.69 45

*** Putative Vector Insertion (Chr 14: 28299648 - 28300137) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000619215 Chr14:28298279..28298319 No primer for this exon
downstream ENSMUSE00000619214 Chr14:28297251..28297504 CTGGGTTGAAGGCCTAGACA Chr14:28297254..28297273 60.25 55
downstream ENSMUSE00000619213 Chr14:28296994..28297118 GCCCCTTAAGGATAGCTTGC Chr14:28296989..28297008 60.19 55
downstream ENSMUSE00000619212 Chr14:28295598..28295788 AAAATGCTGTTGCGTGGTAA Chr14:28295654..28295673 59.23 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGATCTAATCGCCTTGCAG Chr14:28300072..28300092 61.27 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTTTCAATGATGCGCTACC Chr14:28300098..28300119 59.09 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046753