Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18813
Trapped Gene
Vhlh (ENSMUSG00000033933)
Vector Insertion
Chr 6: 113574373 - 113578085
Public Clones not available
Private Clones OST413739 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000358176 (Chr6:113573995..113574372 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGGACCCGTTCCAATAAT Chr6:113574117..113574136 60.02 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000358176 (Chr6:113573995..113574372 +)
Downstram Exon
ENSMUSE00000222733 (Chr6:113578086..113578208 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGGACCCGTTCCAATAAT Chr6:113574117..113574136 60.02 50 TTGGCAAAAATAGGCTGTCC Chr6:113578197..113578216 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000358176 Chr6:113573995..113574372 GAGGGACCCGTTCCAATAAT Chr6:113574117..113574136 60.02 50

*** Putative Vector Insertion (Chr 6: 113574373 - 113578085) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000222733 Chr6:113578086..113578208 TTGGCAAAAATAGGCTGTCC Chr6:113578197..113578216 60.07 45
downstream ENSMUSE00000354833 Chr6:113579379..113581625 TGGCTCAGTCGCTGTATGTC Chr6:113579526..113579545 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGGAGGCCTGGTTTTAGT Chr6:113577385..113577405 60.63 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGGAGGCCTGGTTTTAGT Chr6:113577385..113577405 60.63 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033933