Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18842
Trapped Gene
Dmrt1 (ENSMUSG00000024837)
Vector Insertion
Chr 19: 25677676 - 25678819
Public Clones not available
Private Clones OST413165 (lexicon)
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000546209 (Chr19:25677677..25678818 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGAAACCACAGCGAGAGGA Chr19:25678420..25678439 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000546209 (Chr19:25677677..25678818 +)
Downstram Exon
ENSMUSE00000517635 (Chr19:25677677..25678818 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGAAACCACAGCGAGAGGA Chr19:25678420..25678439 59.99 50 TCCTCTCGCTGTGGTTTCTT Chr19:25678442..25678461 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000262352 Chr19:25580196..25580691 ACTCCCCGAGCTCTTCATTT Chr19:25580235..25580254 60.21 50
upstream ENSMUSE00000262337 Chr19:25584170..25584353 CGAGCTCCTGGTCAAAAGAG Chr19:25584244..25584263 60.13 55
upstream ENSMUSE00000519178 Chr19:25620309..25620592 TCAGACCCCGCCTACTACAG Chr19:25620383..25620402 60.27 60
upstream ENSMUSE00000620406 Chr19:25634357..25634501 GAAGGCCCCTCCTACTCAGA Chr19:25634468..25634487 60.72 60
upstream ENSMUSE00000620407 Chr19:25634357..25634501 GAAGGCCCCTCCTACTCAGA Chr19:25634468..25634487 60.72 60

*** Putative Vector Insertion (Chr 19: 25677676 - 25678819) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000517635 Chr19:25677677..25678818 TCCTCTCGCTGTGGTTTCTT Chr19:25678442..25678461 59.99 50
downstream ENSMUSE00000546209 Chr19:25677677..25678818 TCCTCTCGCTGTGGTTTCTT Chr19:25678442..25678461 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTCCAGTAATCGCCTTGC Chr19:25677719..25677739 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGATTCTGGCTTGGTCTCC Chr19:25677699..25677719 58.32 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024837