Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1885
Trapped Gene
Nme1 (ENSMUSG00000037601)
Vector Insertion
Chr 11: 93822150 - 93824540
Public Clones AY0672 (sanger) RRM029 (baygenomics) RRM030 (baygenomics) RRM028 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000110582 (Chr11:93824541..93824642 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGACCTTCTCAAGGAGCA Chr11:93824617..93824636 59.53 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000110582 (Chr11:93824541..93824642 -)
Downstram Exon
ENSMUSE00000674585 (Chr11:93822023..93822149 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGACCTTCTCAAGGAGCA Chr11:93824617..93824636 59.53 55 GGTTGGTCTCTCCAAGCATC Chr11:93822015..93822034 59.66 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000376631 Chr11:93829535..93829574 GCGGTAAAGCCTTGTCATCT Chr11:93829541..93829560 59.34 50
upstream ENSMUSE00000674586 Chr11:93829535..93829586 GCGGTAAAGCCTTGTCATCT Chr11:93829541..93829560 59.34 50
upstream ENSMUSE00000110585 Chr11:93827122..93827251 AGATCATCAAGCGGTTCGAG Chr11:93827161..93827180 60.36 50
upstream ENSMUSE00000713683 Chr11:93827122..93827251 AGATCATCAAGCGGTTCGAG Chr11:93827161..93827180 60.36 50
upstream ENSMUSE00000110582 Chr11:93824541..93824642 GAGGACCTTCTCAAGGAGCA Chr11:93824617..93824636 59.53 55

*** Putative Vector Insertion (Chr 11: 93822150 - 93824540) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000674585 Chr11:93822023..93822149 GGTTGGTCTCTCCAAGCATC Chr11:93822015..93822034 59.66 55
downstream ENSMUSE00000110586 Chr11:93821982..93822094 CTCGTATGGTCCCAGGCTTA Chr11:93821985..93822004 60.09 55
downstream ENSMUSE00000382394 Chr11:93820547..93820827 AGTGGCACGTAACACTGCAC Chr11:93820549..93820568 59.83 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGTGGTTGCTATGGTGAG Chr11:93824534..93824554 59.16 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGACCAGTGGTTGCTATGG Chr11:93824538..93824558 59.99 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037601