Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18850
Trapped Gene
Mpdu1 (ENSMUSG00000018761)
Vector Insertion
Chr 11: 69472379 - 69475970
Public Clones (sanger) 3SE223G08 (ggtc) E051D02 (ggtc) CMHD-GT_495D12-3 (cmhd) CMHD-GT_495E12-3 (cmhd)
IST10726A7 (tigm) IST11076F6 (tigm) IST14707A8 (tigm) IST11225H1 (tigm)
IST14765A12 (tigm) IST14767A12 (tigm)
Private Clones OST413064 (lexicon) OST406227 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000329630 (Chr11:69475971..69476073 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000329630 (Chr11:69475971..69476073 -)
Downstram Exon
ENSMUSE00000329624 (Chr11:69472313..69472378 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000329630 Chr11:69475971..69476073 No primer for this exon
upstream ENSMUSE00000706015 Chr11:69475971..69476073 No primer for this exon

*** Putative Vector Insertion (Chr 11: 69472379 - 69475970) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000329624 Chr11:69472313..69472378 No primer for this exon
downstream ENSMUSE00000111810 Chr11:69472068..69472200 No primer for this exon
downstream ENSMUSE00000111813 Chr11:69471438..69471523 No primer for this exon
downstream ENSMUSE00000111811 Chr11:69471227..69471345 No primer for this exon
downstream ENSMUSE00000111809 Chr11:69470922..69471032 No primer for this exon
downstream ENSMUSE00000588590 Chr11:69470922..69471032 No primer for this exon
downstream ENSMUSE00000588587 Chr11:69470655..69470713 No primer for this exon
downstream ENSMUSE00000334135 Chr11:69470205..69470830 No primer for this exon
downstream ENSMUSE00000588588 Chr11:69470205..69470830 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGCCTTGAACCGTTAATC Chr11:69475914..69475934 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTTCGTGCAATGGGACTT Chr11:69475977..69475997 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGCTGGTGCCAATTCTAATC Chr11:69473018..69473038 58.72 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATTCCGTGACTGGGAAAACC Chr11:69473007..69473027 61.12 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018761