Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18853
Trapped Gene
St8sia1 (ENSMUSG00000030283)
Vector Insertion
Chr 6: 142862689 - 142912055
Public Clones (ggtc) (ggtc)
Private Clones OST412972 (lexicon) OST391629 (lexicon) OST217926 (lexicon) OST69132 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000336487 (Chr6:142912056..142912972 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCGAAGATCCTTGTAGCTG Chr6:142912449..142912468 59.98 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000336487 (Chr6:142912056..142912972 -)
Downstram Exon
ENSMUSE00000294871 (Chr6:142862544..142862688 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCGAAGATCCTTGTAGCTG Chr6:142912449..142912468 59.98 55 CGTGGAATTATCGATGGTGA Chr6:142862540..142862559 59.35 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000336487 Chr6:142912056..142912972 GGCGAAGATCCTTGTAGCTG Chr6:142912449..142912468 59.98 55

*** Putative Vector Insertion (Chr 6: 142862689 - 142912055) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000294871 Chr6:142862544..142862688 CGTGGAATTATCGATGGTGA Chr6:142862540..142862559 59.35 45
downstream ENSMUSE00000197044 Chr6:142825168..142825277 ATCTATTTGACGGCCACAGC Chr6:142825166..142825185 60.1 50
downstream ENSMUSE00000197047 Chr6:142816374..142816466 GCGAATTATGCTGGGGTTAG Chr6:142816357..142816376 59.57 50
downstream ENSMUSE00000341920 Chr6:142770061..142777790 CAGACTCTAGGCCATGCACA Chr6:142776174..142776193 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCATCCCTTGTCTGATCCT Chr6:142864039..142864059 61.4 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCCGGAGAGAACGAACATT Chr6:142885072..142885092 60.88 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr6:142864903..142864923 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CACCCTGGCAGTCTTCATTG Chr6:142864985..142865005 61.65 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030283