Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18855
Trapped Gene
Hexa (ENSMUSG00000025232)
Vector Insertion
Chr 9: 59404726 - 59405094
Public Clones not available
Private Clones OST412942 (lexicon) OST364866 (lexicon) OST364588 (lexicon) OST356419 (lexicon)
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000232856 (Chr9:59404679..59404725 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAGTCAGCTTGTTTGGAAATC Chr9:59404691..59404712 59.36 40.91 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000232856 (Chr9:59404679..59404725 +)
Downstram Exon
ENSMUSE00000232837 (Chr9:59405095..59405205 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAGTCAGCTTGTTTGGAAATC Chr9:59404691..59404712 59.36 40.91 GGCGAGATGTATCCAGCAGT Chr9:59405173..59405192 60.25 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000232908 Chr9:59387504..59387783 GACGCTACCGTAACCTGCTC Chr9:59387727..59387746 59.9 60
upstream ENSMUSE00000232890 Chr9:59401940..59402032 CAAACGTTGGGGAAGAACAT Chr9:59401948..59401967 59.83 45
upstream ENSMUSE00000232873 Chr9:59403146..59403211 CCAGTGTTTACTCGCCTCTGA Chr9:59403168..59403188 60.44 52.38
upstream ENSMUSE00000232856 Chr9:59404679..59404725 TCAGTCAGCTTGTTTGGAAATC Chr9:59404691..59404712 59.36 40.91

*** Putative Vector Insertion (Chr 9: 59404726 - 59405094) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000232837 Chr9:59405095..59405205 GGCGAGATGTATCCAGCAGT Chr9:59405173..59405192 60.25 55
downstream ENSMUSE00000149101 Chr9:59405841..59405942 GAAGGAAGAGTCGTCCACCA Chr9:59405906..59405925 60.24 55
downstream ENSMUSE00000149110 Chr9:59407131..59407263 AAAGTGTGGCCAGGAGTGTC Chr9:59407252..59407271 60.16 55
downstream ENSMUSE00000149100 Chr9:59408704..59408884 AAAGTCCGGGAAGACTGAGC Chr9:59408846..59408865 60.77 55
downstream ENSMUSE00000149106 Chr9:59409750..59409833 No primer for this exon
downstream ENSMUSE00000149107 Chr9:59410103..59410175 TCAGAGACGATGTCCAGCAG Chr9:59410126..59410145 60.14 55
downstream ENSMUSE00000149104 Chr9:59410674..59410857 GTTCAGGTACCAGGGAGCAG Chr9:59410799..59410818 59.72 60
downstream ENSMUSE00000149111 Chr9:59411031..59411121 CTCCAATGACCAGAGCCTTC Chr9:59411066..59411085 59.8 55
downstream ENSMUSE00000149105 Chr9:59411690..59411794 ACAACGGAAATGCGACAAAC Chr9:59411786..59411805 60.93 45
downstream ENSMUSE00000232641 Chr9:59412628..59412914 TCAAAGGACAGCAACCTCCT Chr9:59412734..59412753 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000025232