Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18859
Trapped Gene
Slc31a1 (ENSMUSG00000066150)
Vector Insertion
Chr 4: 62021878 - 62046525
Public Clones (sanger) (sanger) (sanger) (ggtc) E058G07 (ggtc) (ggtc)
IST14225D5 (tigm)
Private Clones OST412877 (lexicon) OST394007 (lexicon) OST368353 (lexicon) OST318943 (lexicon)
OST316565 (lexicon) OST308253 (lexicon) OST278181 (lexicon) OST275809 (lexicon)
OST271288 (lexicon) OST271083 (lexicon) OST269325 (lexicon) OST260855 (lexicon)
OST252084 (lexicon) OST250805 (lexicon) OST249891 (lexicon) OST239361 (lexicon)
OST237398 (lexicon) OST237397 (lexicon) OST225155 (lexicon) OST207790 (lexicon)
OST207599 (lexicon) OST206910 (lexicon) OST206892 (lexicon) OST200832 (lexicon)
OST191833 (lexicon) OST141847 (lexicon) OST116500 (lexicon) OST113956 (lexicon)
OST96832 (lexicon) OST54551 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000526773 (Chr4:62021754..62021877 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGCTTGGTAGAAGTCCGTA Chr4:62021798..62021817 59.19 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000526773 (Chr4:62021754..62021877 +)
Downstram Exon
ENSMUSE00000526772 (Chr4:62046526..62046712 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGCTTGGTAGAAGTCCGTA Chr4:62021798..62021817 59.19 55 TGGCATGGTAATGTTGTCGT Chr4:62046649..62046668 59.85 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000526773 Chr4:62021754..62021877 GGGCTTGGTAGAAGTCCGTA Chr4:62021798..62021817 59.19 55

*** Putative Vector Insertion (Chr 4: 62021878 - 62046525) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000526772 Chr4:62046526..62046712 TGGCATGGTAATGTTGTCGT Chr4:62046649..62046668 59.85 45
downstream ENSMUSE00000714463 Chr4:62046535..62046712 TGGCATGGTAATGTTGTCGT Chr4:62046649..62046668 59.85 45
downstream ENSMUSE00000526771 Chr4:62047125..62047197 TGATTACCAAACCGGAAAACA Chr4:62047187..62047207 60.21 38.1
downstream ENSMUSE00000526770 Chr4:62048901..62049069 GGCATGGAATTGTAGCGAAT Chr4:62049021..62049040 59.93 45
downstream ENSMUSE00000716117 Chr4:62048901..62052803 CCGGGAGCTTACAGTCTCTG Chr4:62052726..62052745 60.01 60
downstream ENSMUSE00000526769 Chr4:62049632..62052802 CCGGGAGCTTACAGTCTCTG Chr4:62052726..62052745 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr4:62036928..62036948 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTTCGTGACTGGGAAAAC Chr4:62036924..62036944 59.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066150