Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18870
Trapped Gene
Enc1 (ENSMUSG00000041773)
Vector Insertion
Chr 13: 98016740 - 98020491
Public Clones not available
Private Clones OST412698 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000296933 (Chr13:98014926..98016739 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGAGACGGAAGACGAAAG Chr13:98015542..98015561 59.98 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000296933 (Chr13:98014926..98016739 +)
Downstram Exon
ENSMUSE00000296921 (Chr13:98020492..98022988 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGAGACGGAAGACGAAAG Chr13:98015542..98015561 59.98 55 AGCAGCCGAGACCAAAGTTA Chr13:98021526..98021545 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000450084 Chr13:98011060..98011484 GTAGCAGCAGATCCGGAGAC Chr13:98011275..98011294 59.98 60
upstream ENSMUSE00000296933 Chr13:98014926..98016739 CTGGAGACGGAAGACGAAAG Chr13:98015542..98015561 59.98 55

*** Putative Vector Insertion (Chr 13: 98016740 - 98020491) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000296921 Chr13:98020492..98022988 AGCAGCCGAGACCAAAGTTA Chr13:98021526..98021545 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCACGCATGAGGTAAGAGC Chr13:98016729..98016749 60.57 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCACGCATGAGGTAAGAGC Chr13:98016729..98016749 60.57 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041773