Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18890
Trapped Gene
Tmem16a (ENSMUSG00000031075)
Vector Insertion
Chr 7: 151800830 - 151804753
Public Clones not available
Private Clones OST412238 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000266873 (Chr7:151804754..151804825 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCCAGAGCAGAGTATGAAGC Chr7:151804800..151804821 59.88 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000266873 (Chr7:151804754..151804825 -)
Downstram Exon
ENSMUSE00000266865 (Chr7:151800755..151800829 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCCAGAGCAGAGTATGAAGC Chr7:151804800..151804821 59.88 50 GTGAAATAGGCTGGGAATCG Chr7:151800758..151800777 59.53 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000447368 Chr7:151924268..151924448 No primer for this exon
upstream ENSMUSE00000720795 Chr7:151924268..151924383 No primer for this exon
upstream ENSMUSE00000719207 Chr7:151924265..151924461 No primer for this exon
upstream ENSMUSE00000447333 Chr7:151864539..151864684 CGTCCACATCGTGAACATCT Chr7:151864580..151864599 59.55 50
upstream ENSMUSE00000715023 Chr7:151864539..151864684 CGTCCACATCGTGAACATCT Chr7:151864580..151864599 59.55 50
upstream ENSMUSE00000351056 Chr7:151855248..151855580 GCCGAATGCAAGTATGGACT Chr7:151855531..151855550 60.1 50
upstream ENSMUSE00000266728 Chr7:151842920..151843018 GGTGTCGGGTTTGTGAAGAT Chr7:151842987..151843006 59.83 50
upstream ENSMUSE00000266716 Chr7:151841504..151841655 AACCATCAACTCGGTTCTGC Chr7:151841601..151841620 60.12 50
upstream ENSMUSE00000266707 Chr7:151840109..151840163 CCTGACTGACAGGGACTCTTTT Chr7:151840136..151840157 59.78 50
upstream ENSMUSE00000266698 Chr7:151836408..151836459 GAAGAGAACAACGTGCACCA Chr7:151836426..151836445 59.88 50
upstream ENSMUSE00000266686 Chr7:151833929..151833984 GGCCAATGGCGTATACTCAG Chr7:151833949..151833968 60.49 55
upstream ENSMUSE00000352150 Chr7:151830613..151830654 TGAGGGTGACAACGTTGAGT Chr7:151830627..151830646 59.15 50
upstream ENSMUSE00000266908 Chr7:151824405..151824469 CAAATACCAGCCCATTGACC Chr7:151824412..151824431 60.19 50
upstream ENSMUSE00000266898 Chr7:151822980..151823114 GGTGAGAAGGTTGGCCTGTA Chr7:151823085..151823104 60.11 55
upstream ENSMUSE00000266889 Chr7:151819501..151819661 CTGCCACCGTCTTCTTCTCT Chr7:151819520..151819539 59.6 55
upstream ENSMUSE00000402934 Chr7:151807573..151807655 TCAACTACCGATGGGACCTC Chr7:151807594..151807613 59.93 55
upstream ENSMUSE00000721418 Chr7:151805380..151805391 No primer for this exon
upstream ENSMUSE00000266873 Chr7:151804754..151804825 ATCCCAGAGCAGAGTATGAAGC Chr7:151804800..151804821 59.88 50

*** Putative Vector Insertion (Chr 7: 151800830 - 151804753) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000266865 Chr7:151800755..151800829 GTGAAATAGGCTGGGAATCG Chr7:151800758..151800777 59.53 50
downstream ENSMUSE00000266859 Chr7:151797519..151797720 CAATGCAGCCGTAAACTTCA Chr7:151797518..151797537 59.87 45
downstream ENSMUSE00000266851 Chr7:151797240..151797351 GGAAGGCCTTGAAGGTTAGC Chr7:151797276..151797295 60.21 55
downstream ENSMUSE00000266844 Chr7:151796748..151796805 CGGAAAGAGCGGAAGATGTA Chr7:151796736..151796755 60.34 50
downstream ENSMUSE00000525773 Chr7:151794755..151794855 CAGCTGGATACAGAGCTCCA Chr7:151794792..151794811 59.14 55
downstream ENSMUSE00000205995 Chr7:151793823..151793968 CGAAAGGTTCGAGGTTGAAG Chr7:151793831..151793850 59.85 50
downstream ENSMUSE00000205997 Chr7:151789346..151789498 TGTTTAGCAGGGCGAAGAGT Chr7:151789405..151789424 60.01 50
downstream ENSMUSE00000206004 Chr7:151783086..151783138 TAATGATGACAGCCAGCTTCC Chr7:151783066..151783086 60.23 47.62
downstream ENSMUSE00000266811 Chr7:151781347..151781531 GAGAGCGTGTGATTGACGAA Chr7:151781406..151781425 59.99 50
downstream ENSMUSE00000205996 Chr7:151778606..151778711 GGGGTTCCCGGTAATCTTTA Chr7:151778667..151778686 60.01 50
downstream ENSMUSE00000407801 Chr7:151774568..151776170 TGCTCCTCACGCATAAACAG Chr7:151776027..151776046 60.01 50
downstream ENSMUSE00000709689 Chr7:151774454..151776170 TGCTCCTCACGCATAAACAG Chr7:151776027..151776046 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACAAAGAGGTACAGGCTCTGC Chr7:151801739..151801761 59.95 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACAAAGAGGTACAGGCTCTGC Chr7:151801739..151801761 59.95 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031075