Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18892
Trapped Gene
Zfand6 (ENSMUSG00000030629)
Vector Insertion
Chr 7: 91781267 - 91782394
Public Clones not available
Private Clones OST412220 (lexicon) OST261513 (lexicon) OST223230 (lexicon)
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000201419 (Chr7:91782395..91782503 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTGTCCCAGACGCTCAGTC Chr7:91782431..91782450 60.47 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000201419 (Chr7:91782395..91782503 -)
Downstram Exon
ENSMUSE00000201420 (Chr7:91781166..91781266 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTGTCCCAGACGCTCAGTC Chr7:91782431..91782450 60.47 60 ACTGTCCACTTGGGAAGGTG Chr7:91781187..91781206 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000448001 Chr7:91827820..91827900 CAGGTTTGGTTGCTTTGGAG Chr7:91827881..91827900 60.66 50
upstream ENSMUSE00000201418 Chr7:91782749..91782919 GCTGCGGATTTTATGGAAAC Chr7:91782834..91782853 59.55 45
upstream ENSMUSE00000201419 Chr7:91782395..91782503 AGTGTCCCAGACGCTCAGTC Chr7:91782431..91782450 60.47 60

*** Putative Vector Insertion (Chr 7: 91781267 - 91782394) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000201420 Chr7:91781166..91781266 ACTGTCCACTTGGGAAGGTG Chr7:91781187..91781206 60 55
downstream ENSMUSE00000201414 Chr7:91769378..91769422 No primer for this exon
downstream ENSMUSE00000201415 Chr7:91766360..91766473 GGCTGCTGTGTCGTATCTGA Chr7:91766424..91766443 60.02 55
downstream ENSMUSE00000201416 Chr7:91763564..91764478 ATCAAAAGGGAATCGTGCTG Chr7:91763920..91763939 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCATCTATGCAGCCAGGGTA Chr7:91782390..91782410 59.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTACCGTGACTGGGAAAACC Chr7:91782327..91782347 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030629