Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18905
Trapped Gene
Ncoa7 (ENSMUSG00000039697)
Vector Insertion
Chr 10: 30491647 - 30522634
Public Clones (sanger) IST11972D2 (tigm) IST14948B10 (tigm) IST12312H3 (tigm) IST12312H3 (tigm)
IST11442C1 (tigm) IST12830C1 (tigm) IST12832B1 (tigm) IST14951H10 (tigm)
IST12564F1 (tigm) IST12127C9 (tigm) IST12564F1 (tigm) IST11190F8 (tigm)
IST11604G10 (tigm) IST10043E2 (tigm) IST11190E8 (tigm) IST10041G4 (tigm)
Private Clones OST411723 (lexicon) OST355270 (lexicon) OST331908 (lexicon) OST190029 (lexicon)
OST68132 (lexicon) OST67436 (lexicon) OST58198 (lexicon) OST57045 (lexicon)
OST54574 (lexicon) OST35162 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000576767 (Chr10:30522635..30522744 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000576767 (Chr10:30522635..30522744 -)
Downstram Exon
ENSMUSE00000457172 (Chr10:30491526..30491646 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTTCCGTTCCTTCTGTTCCT Chr10:30491521..30491540 58.76 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000576767 Chr10:30522635..30522744 No primer for this exon

*** Putative Vector Insertion (Chr 10: 30491647 - 30522634) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000457172 Chr10:30491526..30491646 TTTCCGTTCCTTCTGTTCCT Chr10:30491521..30491540 58.76 45
downstream ENSMUSE00000457151 Chr10:30442452..30442672 TGCGCCTGATTTCCTTTAAC Chr10:30442457..30442476 60.21 45
downstream ENSMUSE00000457145 Chr10:30424407..30424486 GGCTTTTGGACCATCATCTT Chr10:30424407..30424426 58.98 45
downstream ENSMUSE00000457142 Chr10:30421725..30421832 TGCAACAGAGTTGAGGGTGT Chr10:30421778..30421797 59.31 50
downstream ENSMUSE00000457139 Chr10:30417936..30418049 No primer for this exon
downstream ENSMUSE00000457134 Chr10:30415874..30415999 GACCCTCTCGATGGGTTTTA Chr10:30415933..30415952 58.98 50
downstream ENSMUSE00000457130 Chr10:30413875..30414059 GCAAGGCGTCTTTGATCTTC Chr10:30413857..30413876 59.96 50
downstream ENSMUSE00000430526 Chr10:30410563..30411593 CCCATTCTGCTGTCGTTTTT Chr10:30411445..30411464 60.11 45
downstream ENSMUSE00000430523 Chr10:30409510..30409678 GGCGGGGTCTTACTCTTCTC Chr10:30409617..30409636 60.21 60
downstream ENSMUSE00000430520 Chr10:30382100..30382247 TCCTTGGCATCTTTCCCATA Chr10:30382160..30382179 60.4 45
downstream ENSMUSE00000615004 Chr10:30375443..30375517 AGGCCTGGCACAATAGAAAA Chr10:30375442..30375461 59.71 45
downstream ENSMUSE00000666505 Chr10:30375443..30375623 AGGCCTGGCACAATAGAAAA Chr10:30375442..30375461 59.71 45
downstream ENSMUSE00000386110 Chr10:30374117..30374248 GGGGCTGTAGGATAGGCAGT Chr10:30374130..30374149 60.48 60
downstream ENSMUSE00000342960 Chr10:30372742..30372894 CTTCAAGCTCGTTCCATGCT Chr10:30372789..30372808 60.54 50
downstream ENSMUSE00000318639 Chr10:30368251..30368346 TCGCCTGTGCCATAATAGTG Chr10:30368263..30368282 59.71 50
downstream ENSMUSE00000576772 Chr10:30367773..30367846 CCTCCACCACCAAGTTCTAAAG Chr10:30367751..30367772 60.03 50
downstream ENSMUSE00000471047 Chr10:30366133..30367457 GAGTTGCTGCGTCCATGATA Chr10:30367382..30367401 59.83 50
downstream ENSMUSE00000644318 Chr10:30366133..30367457 GAGTTGCTGCGTCCATGATA Chr10:30367382..30367401 59.83 50
downstream ENSMUSE00000666504 Chr10:30356342..30356365 AATGGCCAAGGTGAGAGATG Chr10:30356322..30356341 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATTTAATCGCCTTGCAGCAC Chr10:30513566..30513587 60.24 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCCTTTGTTCGTGACTGG Chr10:30519574..30519594 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAGAGCCAGCTGCAACATAA Chr10:30519691..30519711 58.68 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAACACGTGACTGGGAAAAC Chr10:30519679..30519699 59.03 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039697