Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18912
Trapped Gene
Tmem85 (ENSMUSG00000027131)
Vector Insertion
Chr 2: 112207674 - 112207975
Public Clones not available
Private Clones OST411084 (lexicon) OST276788 (lexicon) OST240838 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000166377 (Chr2:112207976..112208135 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTACCTGCAGAACGCAAGC Chr2:112208102..112208121 61.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000166377 (Chr2:112207976..112208135 -)
Downstram Exon
ENSMUSE00000166376 (Chr2:112207559..112207673 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTACCTGCAGAACGCAAGC Chr2:112208102..112208121 61.1 55 GGTCTCTTGCACGCTGGTAT Chr2:112207558..112207577 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000166377 Chr2:112207976..112208135 CTTACCTGCAGAACGCAAGC Chr2:112208102..112208121 61.1 55

*** Putative Vector Insertion (Chr 2: 112207674 - 112207975) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000166376 Chr2:112207559..112207673 GGTCTCTTGCACGCTGGTAT Chr2:112207558..112207577 60.28 55
downstream ENSMUSE00000166378 Chr2:112204309..112204462 TGGCCATAAGTGCTTGAATG Chr2:112204296..112204315 59.69 45
downstream ENSMUSE00000166379 Chr2:112203949..112204109 AAGGCTAGCCAGTCTGATGC Chr2:112203943..112203962 59.6 55
downstream ENSMUSE00000166380 Chr2:112203180..112203511 CTCACCACAGGAGGCTCTTC Chr2:112203344..112203363 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTCGAGTGAAGCTCGGTATC Chr2:112207946..112207967 59.59 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027131