Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18914
Trapped Gene
2500004C02Rik (ENSMUSG00000073236)
Vector Insertion
Chr 2: 153168601 - 153171356
Public Clones (ggtc) (ggtc) CMHD-GT_394C10-3 (cmhd) CMHD-GT_384C5-3 (cmhd) CMHD-GT_405H7-3 (cmhd)
CMHD-GT_378C2-3 (cmhd) CMHD-GT_479G6-3 (cmhd) IST11970F3 (tigm) IST10472A5 (tigm)
Private Clones OST411064 (lexicon) OST397378 (lexicon) OST383623 (lexicon) OST382227 (lexicon)
OST346362 (lexicon) OST296660 (lexicon) OST259475 (lexicon) OST240084 (lexicon)
OST230371 (lexicon) OST174083 (lexicon) OST156064 (lexicon) OST155969 (lexicon)
OST42211 (lexicon) OST34537 (lexicon) OST28593 (lexicon) OST22250 (lexicon)
OST20330 (lexicon) OST19298 (lexicon) OST13531 (lexicon) OST8378 (lexicon)
OST1390 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681615 (Chr2:153171357..153171457 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTTTCCGCCCACTTTCTTC Chr2:153171382..153171401 60.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681615 (Chr2:153171357..153171457 -)
Downstram Exon
ENSMUSE00000681614 (Chr2:153166893..153168600 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTTTCCGCCCACTTTCTTC Chr2:153171382..153171401 60.97 50 TGGCACCCCTGTTAACTTTC Chr2:153168550..153168569 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681615 Chr2:153171357..153171457 GTTTTCCGCCCACTTTCTTC Chr2:153171382..153171401 60.97 50

*** Putative Vector Insertion (Chr 2: 153168601 - 153171356) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681614 Chr2:153166893..153168600 TGGCACCCCTGTTAACTTTC Chr2:153168550..153168569 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr2:153171286..153171306 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCAAGCACGGTAAAGAAGG Chr2:153171345..153171365 60.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTAATCGCCTTGCAGCACAT Chr2:153171388..153171408 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTACCCCTCTCCGGAAGAAA Chr2:153171451..153171471 60.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000073236