Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18915
Trapped Gene
Trmt5 (ENSMUSG00000034442)
Vector Insertion
Chr 12: 74386263 - 74387670
Public Clones not available
Private Clones OST411052 (lexicon) OST377852 (lexicon) OST306634 (lexicon) OST187666 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000684083 (Chr12:74387671..74387690 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000684083 (Chr12:74387671..74387690 -)
Downstram Exon
ENSMUSE00000351096 (Chr12:74385622..74386262 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTGGCATGGTTGAGAGTCCT Chr12:74386083..74386102 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684083 Chr12:74387671..74387690 No primer for this exon
upstream ENSMUSE00000706277 Chr12:74387671..74387694 No primer for this exon

*** Putative Vector Insertion (Chr 12: 74386263 - 74387670) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000351096 Chr12:74385622..74386262 CTGGCATGGTTGAGAGTCCT Chr12:74386083..74386102 60.26 55
downstream ENSMUSE00000298250 Chr12:74383599..74383723 CCTGGGTTTTTGTCAACCAT Chr12:74383674..74383693 59.69 45
downstream ENSMUSE00000298244 Chr12:74381992..74382643 GCTGACAATCCTAGCCGAAG Chr12:74382287..74382306 59.98 55
downstream ENSMUSE00000654140 Chr12:74380999..74381619 TGCCGTTTAAGAGGTGGTTC Chr12:74381567..74381586 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr12:74387602..74387622 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAACGTGACTGGGAAAAC Chr12:74387604..74387624 59.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034442