Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18922
Trapped Gene
Rdm1 (ENSMUSG00000010362)
Vector Insertion
Chr 11: 101489767 - 101491551
Public Clones IST12316B1 (tigm) IST13339G2 (tigm) IST10921E1 (tigm) IST10672D9 (tigm)
Private Clones OST410968 (lexicon) OST122778 (lexicon)
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000113082 (Chr11:101489587..101489766 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000113082 (Chr11:101489587..101489766 +)
Downstram Exon
ENSMUSE00000113079 (Chr11:101491552..101491674 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000113080 Chr11:101489274..101489378 No primer for this exon
upstream ENSMUSE00000113082 Chr11:101489587..101489766 No primer for this exon

*** Putative Vector Insertion (Chr 11: 101489767 - 101491551) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000113079 Chr11:101491552..101491674 No primer for this exon
downstream ENSMUSE00000113085 Chr11:101492134..101492293 No primer for this exon
downstream ENSMUSE00000113083 Chr11:101495116..101495214 No primer for this exon
downstream ENSMUSE00000113081 Chr11:101496102..101496187 No primer for this exon
downstream ENSMUSE00000342882 Chr11:101497062..101497395 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGAAACCCCTTTTTCAGAC Chr11:101489735..101489755 59.78 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGAAACCCCTTTTTCAGAC Chr11:101489735..101489755 59.78 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000010362