Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18928
Trapped Gene
1300017J02Rik (ENSMUSG00000033688)
Vector Insertion
Chr 9: 103184998 - 103190510
Public Clones not available
Private Clones OST410854 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000447188 (Chr9:103190511..103190627 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCCTTCTGGGTAAAGTGC Chr9:103190600..103190619 59.88 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000447188 (Chr9:103190511..103190627 -)
Downstram Exon
ENSMUSE00000220722 (Chr9:103184825..103184997 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCCTTCTGGGTAAAGTGC Chr9:103190600..103190619 59.88 55 GACACAACGCACCATCGTAT Chr9:103184927..103184946 59.45 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000447188 Chr9:103190511..103190627 CTGCCTTCTGGGTAAAGTGC Chr9:103190600..103190619 59.88 55

*** Putative Vector Insertion (Chr 9: 103184998 - 103190510) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220722 Chr9:103184825..103184997 GACACAACGCACCATCGTAT Chr9:103184927..103184946 59.45 50
downstream ENSMUSE00000220733 Chr9:103183365..103183473 ACCAAAGCTCCGTCAACAGT Chr9:103183411..103183430 59.77 50
downstream ENSMUSE00000220740 Chr9:103181703..103181864 GAGCTGGTTCAGTTGGAAGC Chr9:103181775..103181794 60 55
downstream ENSMUSE00000319492 Chr9:103179786..103179933 AGGAGCAGGCACACTTGTCT Chr9:103179801..103179820 60.06 55
downstream ENSMUSE00000220715 Chr9:103177271..103177326 TGCTTCACGAAGCTCACATC Chr9:103177263..103177282 60.14 50
downstream ENSMUSE00000319463 Chr9:103174817..103174995 CAGCTCGTATTGGTCCCTGT Chr9:103174933..103174952 60.13 55
downstream ENSMUSE00000220709 Chr9:103171942..103172113 CTTTCGAGGGACCCTTAGGA Chr9:103171981..103172000 60.56 55
downstream ENSMUSE00000220744 Chr9:103170642..103170784 CACAGCACTCCACTGGTCAC Chr9:103170683..103170702 60.37 60
downstream ENSMUSE00000220739 Chr9:103169962..103170052 AGTTCTCTGCCAGGACAGGT Chr9:103169943..103169962 58.9 55
downstream ENSMUSE00000220743 Chr9:103168533..103168589 No primer for this exon
downstream ENSMUSE00000220742 Chr9:103165360..103165515 GATGCCAACATCCGATTTCT Chr9:103165450..103165469 59.9 45
downstream ENSMUSE00000220736 Chr9:103161700..103161841 GTGATACCCCTCAGCGTTGT Chr9:103161698..103161717 60 55
downstream ENSMUSE00000220710 Chr9:103158895..103158959 GTCCCCCTTCTCAACCAGAC Chr9:103158916..103158935 60.89 60
downstream ENSMUSE00000220732 Chr9:103156970..103157154 CGTGTTTCAGACCCTTAGCC Chr9:103157094..103157113 59.73 55
downstream ENSMUSE00000220745 Chr9:103154121..103154307 TGAAAAGCAGGTCCTTAGCTG Chr9:103154210..103154230 59.64 47.62
downstream ENSMUSE00000319192 Chr9:103152860..103152992 CCCCAGCTGAATGGTGTTTA Chr9:103152919..103152938 60.88 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGTAATCGCCTTGCAGCAC Chr9:103187442..103187462 61.78 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTTGGATGCAAGTGCGTGA Chr9:103187454..103187474 62.58 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033688