Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18961
Trapped Gene
Psmb7 (ENSMUSG00000026750)
Vector Insertion
Chr 2: 38495734 - 38497697
Public Clones not available
Private Clones OST408746 (lexicon) OST186233 (lexicon) OST88700 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000162377 (Chr2:38497698..38497795 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGAAGGGATGGTTGTTGC Chr2:38497743..38497762 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000162377 (Chr2:38497698..38497795 -)
Downstram Exon
ENSMUSE00000162384 (Chr2:38495593..38495733 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGAAGGGATGGTTGTTGC Chr2:38497743..38497762 59.97 50 GCTGGGTTGTCATGTCTGTG Chr2:38495665..38495684 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000394392 Chr2:38499361..38499441 GGTCGGAGGCTTTTCTTTTG Chr2:38499374..38499393 61.09 50
upstream ENSMUSE00000162379 Chr2:38498878..38498971 GCTCGGAAAACTGGCACTAC Chr2:38498900..38498919 59.88 55
upstream ENSMUSE00000162377 Chr2:38497698..38497795 ACTGAAGGGATGGTTGTTGC Chr2:38497743..38497762 59.97 50

*** Putative Vector Insertion (Chr 2: 38495734 - 38497697) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000162384 Chr2:38495593..38495733 GCTGGGTTGTCATGTCTGTG Chr2:38495665..38495684 60.16 55
downstream ENSMUSE00000253774 Chr2:38489371..38489486 AAACTAGGGCTGCACCAATG Chr2:38489433..38489452 60.13 50
downstream ENSMUSE00000253762 Chr2:38468952..38469010 No primer for this exon
downstream ENSMUSE00000162380 Chr2:38446217..38446368 AAAGTCCAGCTTGCTCTTGC Chr2:38446233..38446252 59.76 50
downstream ENSMUSE00000253746 Chr2:38443578..38443808 GTATGCACCCCGAGTCATCT Chr2:38443627..38443646 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGAAATCTTCTGGCATGTTG Chr2:38497649..38497671 60.25 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026750