Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18966
Trapped Gene
Dlec1 (ENSMUSG00000038060)
Vector Insertion
Chr 9: 119019330 - 119021174
Public Clones not available
Private Clones OST408563 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000270104 (Chr9:119019219..119019329 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAGCCTTCAGGTGGTGTCT Chr9:119019224..119019243 59.76 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000270104 (Chr9:119019219..119019329 +)
Downstram Exon
ENSMUSE00000270081 (Chr9:119021175..119021362 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAGCCTTCAGGTGGTGTCT Chr9:119019224..119019243 59.76 55 TCCCTGTCCAGCTCTGACTT Chr9:119021256..119021275 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000270129 Chr9:119011627..119012043 TTCCTCGACCGTCTTAATGG Chr9:119011770..119011789 60.07 50
upstream ENSMUSE00000270115 Chr9:119014920..119015070 CACGGGATATTGCAGAAACA Chr9:119014990..119015009 59.54 45
upstream ENSMUSE00000270104 Chr9:119019219..119019329 ACAGCCTTCAGGTGGTGTCT Chr9:119019224..119019243 59.76 55

*** Putative Vector Insertion (Chr 9: 119019330 - 119021174) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000270081 Chr9:119021175..119021362 TCCCTGTCCAGCTCTGACTT Chr9:119021256..119021275 59.99 55
downstream ENSMUSE00000270044 Chr9:119021527..119021744 GCTCAAAGGGACGATGAGAG Chr9:119021703..119021722 59.95 55
downstream ENSMUSE00000270019 Chr9:119024082..119024160 TCGTAAACGGGTCCAATTTC Chr9:119024162..119024181 59.8 45
downstream ENSMUSE00000270002 Chr9:119028766..119028853 CCAGAGCGAAGTACGGAGAG Chr9:119028850..119028869 60.15 60
downstream ENSMUSE00000269983 Chr9:119029921..119030094 AGACAGTCCGGGATGAACTG Chr9:119030002..119030021 60.11 55
downstream ENSMUSE00000269968 Chr9:119030906..119031042 AGCTCTTTTGGGGCATGATA Chr9:119031025..119031044 59.67 45
downstream ENSMUSE00000269940 Chr9:119032263..119032355 ACACGGAAGGCATTACTCCA Chr9:119032323..119032342 60.52 50
downstream ENSMUSE00000269908 Chr9:119033238..119033328 CGACGACCACCTCCTTTATC Chr9:119033328..119033347 59.55 55
downstream ENSMUSE00000481906 Chr9:119033874..119034036 ATCAGATCCAAAGCCACCAG Chr9:119033907..119033926 60.07 50
downstream ENSMUSE00000688816 Chr9:119036106..119036164 No primer for this exon
downstream ENSMUSE00000688814 Chr9:119036534..119036702 TTCACCTCGATTTCCAGGAC Chr9:119036608..119036627 60.05 50
downstream ENSMUSE00000688812 Chr9:119037136..119037229 AGGGCTCCACTTCGATGATA Chr9:119037217..119037236 59.65 50
downstream ENSMUSE00000688810 Chr9:119037382..119037512 GGCCTCAATGTGGAGTACCA Chr9:119037506..119037525 60.92 55
downstream ENSMUSE00000688809 Chr9:119037618..119037776 ATCAATGGTCAAGGCAGGTC Chr9:119037641..119037660 59.93 50
downstream ENSMUSE00000688808 Chr9:119043587..119043810 GCTGAACTCCAAGTGGCTGT Chr9:119043659..119043678 60.45 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCAGCACCCAAAGGTAATC Chr9:119019317..119019337 61.62 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCAGCACCCAAAGGTAATC Chr9:119019317..119019337 61.62 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038060