Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18969
Trapped Gene
Rasgrp2 (ENSMUSG00000032946)
Vector Insertion
Chr 19: 6414042 - 6414791
Public Clones not available
Private Clones OST408534 (lexicon) OST250064 (lexicon) OST21127 (lexicon) OST15942 (lexicon)
OST13922 (lexicon) OST6461 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000490361 (Chr19:6413865..6414041 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGAACTGCCACAAGCAAT Chr19:6413872..6413891 60.31 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000490361 (Chr19:6413865..6414041 +)
Downstram Exon
ENSMUSE00000466930 (Chr19:6414792..6414854 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGAACTGCCACAAGCAAT Chr19:6413872..6413891 60.31 45 CACCTCCTCTTCACGGATCT Chr19:6414814..6414833 59.25 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695762 Chr19:6399340..6399517 AAACCAGCTCGCATTCTGTC Chr19:6399374..6399393 60.41 50
upstream ENSMUSE00000695745 Chr19:6399456..6399517 No primer for this exon
upstream ENSMUSE00000695729 Chr19:6399746..6399811 No primer for this exon
upstream ENSMUSE00000695741 Chr19:6400113..6401863 TGGAGATGCACTGTCTTTGC Chr19:6400503..6400522 59.99 50
upstream ENSMUSE00000499968 Chr19:6400562..6400651 TGAACTGCATTCAGGTTTGC Chr19:6400611..6400630 59.85 45
upstream ENSMUSE00000695727 Chr19:6400623..6400651 No primer for this exon
upstream ENSMUSE00000695736 Chr19:6401702..6401863 ATGACGAGCACTCTGGACCT Chr19:6401791..6401810 59.87 55
upstream ENSMUSE00000413610 Chr19:6401716..6401863 ATGACGAGCACTCTGGACCT Chr19:6401791..6401810 59.87 55
upstream ENSMUSE00000695732 Chr19:6401718..6401863 ATGACGAGCACTCTGGACCT Chr19:6401791..6401810 59.87 55
upstream ENSMUSE00000695760 Chr19:6401721..6401863 ATGACGAGCACTCTGGACCT Chr19:6401791..6401810 59.87 55
upstream ENSMUSE00000235796 Chr19:6402472..6402574 CACAGCTAGTGCGCATGTTT Chr19:6402496..6402515 60.08 50
upstream ENSMUSE00000695731 Chr19:6402552..6402574 GCTTCGAAACTGCTCCACTT Chr19:6402555..6402574 59.62 50
upstream ENSMUSE00000695730 Chr19:6403024..6403086 CGGAAGGACAACTCCAATTC Chr19:6403037..6403056 59.53 50
upstream ENSMUSE00000695804 Chr19:6403024..6403086 CGGAAGGACAACTCCAATTC Chr19:6403037..6403056 59.53 50
upstream ENSMUSE00000551256 Chr19:6403031..6403086 CGGAAGGACAACTCCAATTC Chr19:6403037..6403056 59.53 50
upstream ENSMUSE00000235751 Chr19:6403432..6403563 TTCCCAGCAGAGTTCGACTT Chr19:6403448..6403467 59.99 50
upstream ENSMUSE00000695726 Chr19:6403432..6403612 TTCCCAGCAGAGTTCGACTT Chr19:6403448..6403467 59.99 50
upstream ENSMUSE00000695728 Chr19:6403432..6403485 TTCCCAGCAGAGTTCGACTT Chr19:6403448..6403467 59.99 50
upstream ENSMUSE00000695739 Chr19:6403432..6403638 TTCCCAGCAGAGTTCGACTT Chr19:6403448..6403467 59.99 50
upstream ENSMUSE00000695744 Chr19:6403432..6403633 TTCCCAGCAGAGTTCGACTT Chr19:6403448..6403467 59.99 50
upstream ENSMUSE00000708058 Chr19:6403432..6403638 TTCCCAGCAGAGTTCGACTT Chr19:6403448..6403467 59.99 50
upstream ENSMUSE00000235727 Chr19:6404300..6404450 AAAGCGCAAGATGTCCTTGT Chr19:6404354..6404373 59.88 45
upstream ENSMUSE00000235706 Chr19:6404654..6404827 GTGGGTCCAACTCATGATCC Chr19:6404746..6404765 60.18 55
upstream ENSMUSE00000235684 Chr19:6404938..6405054 ATCTCACGCCTCAAGGAGAC Chr19:6405004..6405023 59.41 55
upstream ENSMUSE00000235665 Chr19:6407041..6407322 CCAAGATGAGGCAGCTTTTC Chr19:6407222..6407241 59.96 50
upstream ENSMUSE00000235644 Chr19:6408171..6408248 No primer for this exon
upstream ENSMUSE00000235623 Chr19:6408448..6408570 CCTCAGTTGCCAAGCCTAAG Chr19:6408506..6408525 60.01 55
upstream ENSMUSE00000235602 Chr19:6408839..6408954 GGGGCAACTTCCCTTATCTC Chr19:6408906..6408925 59.9 55
upstream ENSMUSE00000488493 Chr19:6413085..6413226 GGGCTTCGTACACAACTTCC Chr19:6413157..6413176 59.6 55
upstream ENSMUSE00000487489 Chr19:6413428..6413464 ATCCTGGGCATCTACAAGCA Chr19:6413428..6413447 60.62 50
upstream ENSMUSE00000490361 Chr19:6413865..6414041 TGTGAACTGCCACAAGCAAT Chr19:6413872..6413891 60.31 45

*** Putative Vector Insertion (Chr 19: 6414042 - 6414791) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000466930 Chr19:6414792..6414854 CACCTCCTCTTCACGGATCT Chr19:6414814..6414833 59.25 55
downstream ENSMUSE00000466422 Chr19:6414994..6415212 ATTCGGGCCTTTTTATTCCA Chr19:6415204..6415223 60.62 40
downstream ENSMUSE00000695755 Chr19:6414994..6415210 ATTCGGGCCTTTTTATTCCA Chr19:6415204..6415223 60.62 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr19:6414093..6414113 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCTCTCGGCCTCCAGGTAA Chr19:6414027..6414047 63.57 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032946