Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18977
Trapped Gene
Ugdh (ENSMUSG00000029201)
Vector Insertion
Chr 5: 65815383 - 65818654
Public Clones not available
Private Clones OST408275 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000713325 (Chr5:65818655..65818823 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCAGGGTTACGGTTGTGGA Chr5:65818710..65818729 60.23 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000713325 (Chr5:65818655..65818823 -)
Downstram Exon
ENSMUSE00000186841 (Chr5:65815281..65815382 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCAGGGTTACGGTTGTGGA Chr5:65818710..65818729 60.23 50 TTTTTCCTCGACAGGATTCG Chr5:65815321..65815340 60.18 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000186838 Chr5:65826863..65827117 TTCCCCGGCAGAAGTATTTA Chr5:65826992..65827011 59.54 45
upstream ENSMUSE00000708497 Chr5:65826863..65826970 GTGTCCCTGCTTTGGAAGTG Chr5:65826864..65826883 60.69 55
upstream ENSMUSE00000186828 Chr5:65818655..65818823 ATCAGGGTTACGGTTGTGGA Chr5:65818710..65818729 60.23 50
upstream ENSMUSE00000713325 Chr5:65818655..65818823 ATCAGGGTTACGGTTGTGGA Chr5:65818710..65818729 60.23 50

*** Putative Vector Insertion (Chr 5: 65815383 - 65818654) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000186841 Chr5:65815281..65815382 TTTTTCCTCGACAGGATTCG Chr5:65815321..65815340 60.18 45
downstream ENSMUSE00000186826 Chr5:65814689..65814889 CTGTGCTTTTCTCCGTGACA Chr5:65814738..65814757 60.03 50
downstream ENSMUSE00000186835 Chr5:65814400..65814597 AGGACTCTGTCCGGGTTCTT Chr5:65814505..65814524 60.11 55
downstream ENSMUSE00000186831 Chr5:65813874..65814021 AGAGCGCTGATGGAGTTGAT Chr5:65813944..65813963 59.98 50
downstream ENSMUSE00000186837 Chr5:65811488..65811582 AGCTACTTCGGGCAGATTCA Chr5:65811481..65811500 59.98 50
downstream ENSMUSE00000254523 Chr5:65809717..65809847 ATGATCCGTGATGCAAACCT Chr5:65809776..65809795 60.35 45
downstream ENSMUSE00000186840 Chr5:65808750..65808883 GAGACACCCGGATGAGAAAG Chr5:65808742..65808761 59.65 55
downstream ENSMUSE00000186832 Chr5:65808260..65808351 CTTCGTATGGGTCCTTGGAA Chr5:65808291..65808310 59.93 50
downstream ENSMUSE00000186836 Chr5:65808064..65808174 ACGCCGACCATCAAAGATAA Chr5:65808087..65808106 60.47 45
downstream ENSMUSE00000361457 Chr5:65804465..65805302 CGGAATCTCACCAGGAGTGT Chr5:65805218..65805237 60.11 55
downstream ENSMUSE00000719100 Chr5:65804441..65805302 CGGAATCTCACCAGGAGTGT Chr5:65805218..65805237 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAATTCTCCAACCCTTCCT Chr5:65818662..65818682 59.37 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAATTCTCCAACCCTTCCT Chr5:65818662..65818682 59.37 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029201