Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18980
Trapped Gene
Cd59a (ENSMUSG00000032679)
Vector Insertion
Chr 2: 103951002 - 103954131
Public Clones not available
Private Clones OST407783 (lexicon) OST63609 (lexicon)
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000227056 (Chr2:103950897..103951001 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTTCCAACCGGTGGTTTCT Chr2:103950921..103950940 61.14 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000227056 (Chr2:103950897..103951001 +)
Downstram Exon
ENSMUSE00000227053 (Chr2:103954132..103955342 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTTCCAACCGGTGGTTTCT Chr2:103950921..103950940 61.14 50 TTTTGAGCGTGTCAGAGTGG Chr2:103954738..103954757 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000686771 Chr2:103935994..103936084 CAGTCACTGGCGATCTGAAA Chr2:103936026..103936045 59.98 50
upstream ENSMUSE00000227061 Chr2:103944328..103944406 GAGAGCTCAGAGGGGACTCA Chr2:103944348..103944367 59.66 60
upstream ENSMUSE00000227056 Chr2:103950897..103951001 GTTTCCAACCGGTGGTTTCT Chr2:103950921..103950940 61.14 50

*** Putative Vector Insertion (Chr 2: 103951002 - 103954131) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000227053 Chr2:103954132..103955342 TTTTGAGCGTGTCAGAGTGG Chr2:103954738..103954757 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGTGGTCAGGGATGAGAA Chr2:103954023..103954043 60.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGTGGTCAGGGATGAGAA Chr2:103954023..103954043 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032679