Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18985
Trapped Gene
Lgtn (ENSMUSG00000026427)
Vector Insertion
Chr 1: 133050003 - 133050805
Public Clones (sanger)
Private Clones OST407711 (lexicon) OST389811 (lexicon) OST371809 (lexicon) OST354101 (lexicon)
OST280308 (lexicon) OST172600 (lexicon) OST103941 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000492514 (Chr1:133049773..133050002 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCACTCCTTCGTTTTGTTG Chr1:133049874..133049893 60.67 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000492514 (Chr1:133049773..133050002 +)
Downstram Exon
ENSMUSE00000158959 (Chr1:133050806..133050996 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCACTCCTTCGTTTTGTTG Chr1:133049874..133049893 60.67 50 CGAATCCCCTTTGTGAACAT Chr1:133050932..133050951 59.79 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000492514 Chr1:133049773..133050002 GCCACTCCTTCGTTTTGTTG Chr1:133049874..133049893 60.67 50
upstream ENSMUSE00000502768 Chr1:133049825..133050002 CTGGCGTCTGTGCTCTTCTT Chr1:133049901..133049920 60.73 55

*** Putative Vector Insertion (Chr 1: 133050003 - 133050805) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158959 Chr1:133050806..133050996 CGAATCCCCTTTGTGAACAT Chr1:133050932..133050951 59.79 45
downstream ENSMUSE00000158958 Chr1:133051745..133051828 CCCGACCAGTTTTTCCAATA Chr1:133051824..133051843 59.79 45
downstream ENSMUSE00000250310 Chr1:133052210..133052300 AGGTCGCCTTGCTGTACTTG Chr1:133052276..133052295 60.45 55
downstream ENSMUSE00000250304 Chr1:133054769..133054876 CATCTGAGCTGTGGACATGG Chr1:133054817..133054836 60.27 55
downstream ENSMUSE00000480771 Chr1:133056987..133057201 GAGGCTTCTCGGAGAGGAAC Chr1:133057145..133057164 60.48 60
downstream ENSMUSE00000158978 Chr1:133057862..133057979 GAAGGAAGCACCGCAGTAAC Chr1:133057900..133057919 59.88 55
downstream ENSMUSE00000158974 Chr1:133060097..133060142 No primer for this exon
downstream ENSMUSE00000158975 Chr1:133060980..133061083 CCTTTGCTCAGCTCCTTGAC Chr1:133061047..133061066 60.13 55
downstream ENSMUSE00000158982 Chr1:133061197..133061346 GGGATGACGAAAGACGTGAT Chr1:133061220..133061239 59.93 50
downstream ENSMUSE00000158971 Chr1:133061697..133061786 CGTGATGATCTTTCGGACCT Chr1:133061745..133061764 60.07 50
downstream ENSMUSE00000158984 Chr1:133062904..133062999 GAGCTTCGTGACCAAGTGCT Chr1:133062979..133062998 60.6 55
downstream ENSMUSE00000158973 Chr1:133064697..133064817 GGTCTTCAGTGCAAGGGTGA Chr1:133064808..133064827 61.26 55
downstream ENSMUSE00000516727 Chr1:133067514..133067688 AAGTTCCGGACCACAGTCAC Chr1:133067536..133067555 60.01 55
downstream ENSMUSE00000691714 Chr1:133068498..133068811 TTTCGCTGGACCTCAGTTTT Chr1:133068626..133068645 59.85 45
downstream ENSMUSE00000447257 Chr1:133069881..133070048 ATGGGGTCCACTGCATAAAA Chr1:133069979..133069998 60.19 45
downstream ENSMUSE00000447223 Chr1:133075177..133075218 GAGGAGCAGGACAAGATCCA Chr1:133075203..133075222 60.35 55
downstream ENSMUSE00000691722 Chr1:133079345..133079463 TGGGGGTATTGAGCTGGTAA Chr1:133079390..133079409 60.32 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr1:133050052..133050072 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000026427