Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18986
Trapped Gene
Vsig2 (ENSMUSG00000001943)
Vector Insertion
Chr 9: 37347024 - 37347453
Public Clones not available
Private Clones OST407691 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000701488 (Chr9:37346840..37347023 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000701488 (Chr9:37346840..37347023 +)
Downstram Exon
ENSMUSE00000216880 (Chr9:37347454..37347611 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000701488 Chr9:37346840..37347023 No primer for this exon

*** Putative Vector Insertion (Chr 9: 37347024 - 37347453) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000216880 Chr9:37347454..37347611 No primer for this exon
downstream ENSMUSE00000501005 Chr9:37347879..37348086 No primer for this exon
downstream ENSMUSE00000701485 Chr9:37347961..37348086 No primer for this exon
downstream ENSMUSE00000216891 Chr9:37348912..37349070 No primer for this exon
downstream ENSMUSE00000330356 Chr9:37349940..37350059 No primer for this exon
downstream ENSMUSE00000330336 Chr9:37350174..37350318 No primer for this exon
downstream ENSMUSE00000373970 Chr9:37351595..37351790 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:37347074..37347094 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGGAACGTGACTGGGAAA Chr9:37347068..37347088 63.35 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001943