Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1899
Trapped Gene
Jmjd2c (ENSMUSG00000028397)
Vector Insertion
Chr 4: 74005433 - 74019469
Public Clones AY0368 (sanger) RRU513 (baygenomics) M120C12 (ggtc) M120B12 (ggtc)
IST12316A9 (tigm) IST12316A9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672651 (Chr4:74005324..74005432 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCCCAGAACGGACACAAAT Chr4:74005376..74005395 59.83 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672651 (Chr4:74005324..74005432 +)
Downstram Exon
ENSMUSE00000672650 (Chr4:74019470..74019655 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCCCAGAACGGACACAAAT Chr4:74005376..74005395 59.83 50 ACCACGTAAGGCCAGTCATC Chr4:74019618..74019637 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486245 Chr4:73888401..73888544 No primer for this exon
upstream ENSMUSE00000399503 Chr4:73897783..73897990 GCGGAACAAGTCTTCCAAAG Chr4:73897892..73897911 59.85 50
upstream ENSMUSE00000632197 Chr4:73908713..73908873 GGAGTTTCGGGAGTTCAACA Chr4:73908801..73908820 60.09 50
upstream ENSMUSE00000710008 Chr4:73908713..73908873 GGAGTTTCGGGAGTTCAACA Chr4:73908801..73908820 60.09 50
upstream ENSMUSE00000330084 Chr4:73917098..73917273 CAGCACCAATTCAGCAGATG Chr4:73917162..73917181 60.41 50
upstream ENSMUSE00000330076 Chr4:73926801..73926915 TGGAACGCAAATACTGGAAA Chr4:73926836..73926855 59.16 40
upstream ENSMUSE00000662754 Chr4:73944345..73944538 CACGGAGGACATGGATCTCT Chr4:73944479..73944498 60.07 55
upstream ENSMUSE00000178776 Chr4:73952869..73952918 TATACCTCCGGAGCATGGAA Chr4:73952875..73952894 60.43 50
upstream ENSMUSE00000330062 Chr4:73957551..73957654 GGCACAAGATGACCCTCATT Chr4:73957593..73957612 59.93 50
upstream ENSMUSE00000178777 Chr4:73961416..73961553 TGGATTGACTACGGCAAGGT Chr4:73961524..73961543 60.52 50
upstream ENSMUSE00000178785 Chr4:73976559..73976752 CTTGTCGGAATGACATGGTG Chr4:73976563..73976582 59.96 50
upstream ENSMUSE00000716477 Chr4:73979537..73979772 CCCTAGGCACCTCAAAGTCA Chr4:73979636..73979655 60.25 55
upstream ENSMUSE00000716571 Chr4:73979537..73979772 CCCTAGGCACCTCAAAGTCA Chr4:73979636..73979655 60.25 55
upstream ENSMUSE00000330040 Chr4:73980453..73980772 GGCCATGGAAGTAACCTTGA Chr4:73980695..73980714 59.93 50
upstream ENSMUSE00000672664 Chr4:73980453..73980772 GGCCATGGAAGTAACCTTGA Chr4:73980695..73980714 59.93 50
upstream ENSMUSE00000330032 Chr4:73982786..73982894 AGCAGCAGGTAGCGAGTGAT Chr4:73982871..73982890 60.19 55
upstream ENSMUSE00000672661 Chr4:73982786..73982894 AGCAGCAGGTAGCGAGTGAT Chr4:73982871..73982890 60.19 55
upstream ENSMUSE00000178774 Chr4:73989274..73989455 ACTGTGCCATCTGCACTCTG Chr4:73989418..73989437 60.06 55
upstream ENSMUSE00000672658 Chr4:73989274..73989455 ACTGTGCCATCTGCACTCTG Chr4:73989418..73989437 60.06 55
upstream ENSMUSE00000178775 Chr4:73991347..73991560 CCAAATGCCTTCCTTGAAGA Chr4:73991485..73991504 60.18 45
upstream ENSMUSE00000672656 Chr4:73991347..73991560 CCAAATGCCTTCCTTGAAGA Chr4:73991485..73991504 60.18 45
upstream ENSMUSE00000178784 Chr4:73994304..73994380 GTCTGTGATGGATGGCTGTG Chr4:73994330..73994349 60.12 55
upstream ENSMUSE00000672654 Chr4:73994304..73994380 GTCTGTGATGGATGGCTGTG Chr4:73994330..73994349 60.12 55
upstream ENSMUSE00000178788 Chr4:74003246..74003301 GAGGGGAGGTGCTCTGAAAC Chr4:74003266..74003285 61.17 60
upstream ENSMUSE00000672652 Chr4:74003246..74003301 GAGGGGAGGTGCTCTGAAAC Chr4:74003266..74003285 61.17 60
upstream ENSMUSE00000178782 Chr4:74005324..74005432 GTCCCAGAACGGACACAAAT Chr4:74005376..74005395 59.83 50
upstream ENSMUSE00000672651 Chr4:74005324..74005432 GTCCCAGAACGGACACAAAT Chr4:74005376..74005395 59.83 50

*** Putative Vector Insertion (Chr 4: 74005433 - 74019469) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000178783 Chr4:74019470..74019655 ACCACGTAAGGCCAGTCATC Chr4:74019618..74019637 60 55
downstream ENSMUSE00000672650 Chr4:74019470..74019655 ACCACGTAAGGCCAGTCATC Chr4:74019618..74019637 60 55
downstream ENSMUSE00000178787 Chr4:74023534..74023704 CCGAGTGTTTCGATGTTTTG Chr4:74023605..74023624 59.17 45
downstream ENSMUSE00000672649 Chr4:74023534..74023704 CCGAGTGTTTCGATGTTTTG Chr4:74023605..74023624 59.17 45
downstream ENSMUSE00000178779 Chr4:74037281..74037400 GGCCATTTGACTTGGATGAC Chr4:74037345..74037364 60.33 50
downstream ENSMUSE00000672648 Chr4:74037281..74037400 GGCCATTTGACTTGGATGAC Chr4:74037345..74037364 60.33 50
downstream ENSMUSE00000329972 Chr4:74045251..74045343 CAATCTGCGATCCATCTTCA Chr4:74045281..74045300 59.76 45
downstream ENSMUSE00000672646 Chr4:74045251..74045343 CAATCTGCGATCCATCTTCA Chr4:74045281..74045300 59.76 45
downstream ENSMUSE00000445447 Chr4:74050725..74051765 GTCCCAATGTGTACCCCAAG Chr4:74050985..74051004 60.09 55
downstream ENSMUSE00000662753 Chr4:74050725..74051764 GTCCCAATGTGTACCCCAAG Chr4:74050985..74051004 60.09 55
downstream ENSMUSE00000672645 Chr4:74050725..74051765 GTCCCAATGTGTACCCCAAG Chr4:74050985..74051004 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCAACTTAATCGCCTTGC Chr4:74017476..74017496 58.04 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCAACTCGTGACTGGGAAAA Chr4:74017477..74017498 60.65 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028397