Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19
Trapped Gene
CT025653.7-201 (ENSMUSG00000047412)
Vector Insertion
Chr 9: 30861899 - 30869625
Public Clones GC0257 (tigem) CSA060 (baygenomics) W077D05 (ggtc)
Private Clones OST426850 (lexicon) OST279609 (lexicon) OST68154 (lexicon) OST38554 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000424081 (Chr9:30860825..30861898 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCAGAAAATACCCGGACT Chr9:30861620..30861639 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000424081 (Chr9:30860825..30861898 +)
Downstram Exon
ENSMUSE00000450794 (Chr9:30869626..30869710 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCAGAAAATACCCGGACT Chr9:30861620..30861639 59.96 50 TGGTGCTAGAGGTGCTCTGA Chr9:30869688..30869707 59.73 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702098 Chr9:30838229..30838543 AAGAGGAGGAGCAGTTGCAG Chr9:30838494..30838513 59.74 55
upstream ENSMUSE00000424081 Chr9:30860825..30861898 AGGCAGAAAATACCCGGACT Chr9:30861620..30861639 59.96 50

*** Putative Vector Insertion (Chr 9: 30861899 - 30869625) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000450794 Chr9:30869626..30869710 TGGTGCTAGAGGTGCTCTGA Chr9:30869688..30869707 59.73 55
downstream ENSMUSE00000413910 Chr9:30871764..30871927 TTGGACACTGAAACGGTCTG Chr9:30871870..30871889 59.72 50
downstream ENSMUSE00000702097 Chr9:30871818..30871927 TTGGACACTGAAACGGTCTG Chr9:30871870..30871889 59.72 50
downstream ENSMUSE00000702093 Chr9:30874244..30874327 TTTAGCGAGTAAGCCCTGGT Chr9:30874307..30874326 59 50
downstream ENSMUSE00000363120 Chr9:30874339..30874544 TACTCCCCGAAGGAAGTGAA Chr9:30874388..30874407 59.67 50
downstream ENSMUSE00000702088 Chr9:30874753..30874760 No primer for this exon
downstream ENSMUSE00000638059 Chr9:30876330..30877844 GGGGAAAAGTGCTTTCACAA Chr9:30876487..30876506 60.09 45
downstream ENSMUSE00000702091 Chr9:30876330..30877844 GGGGAAAAGTGCTTTCACAA Chr9:30876487..30876506 60.09 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAAGATTTTAATCGCCTTGC Chr9:30861941..30861962 58.88 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGTCCGTGACTGGGAAAAC Chr9:30861945..30861965 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047412