Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19001
Trapped Gene
Kank2 (ENSMUSG00000032194)
Vector Insertion
Chr 9: 21574571 - 21577188
Public Clones IST14588C12 (tigm) IST14277A1 (tigm)
Private Clones OST407279 (lexicon) OST45094 (lexicon)
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000376094 (Chr9:21577189..21577331 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGACCCAGGACGACATTGAG Chr9:21577240..21577259 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000376094 (Chr9:21577189..21577331 -)
Downstram Exon
ENSMUSE00000702614 (Chr9:21574370..21574570 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGACCCAGGACGACATTGAG Chr9:21577240..21577259 60.11 55 GATCTCCTTGTGTCCGTGCT Chr9:21574399..21574418 60.27 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000389762 Chr9:21602926..21602979 No primer for this exon
upstream ENSMUSE00000702625 Chr9:21600524..21600638 GCTGTTGGGGAGACTCAGTT Chr9:21600598..21600617 59.31 55
upstream ENSMUSE00000393980 Chr9:21598901..21600127 GTCTGGAACCCTACGGAACA Chr9:21599073..21599092 59.97 55
upstream ENSMUSE00000217598 Chr9:21585004..21585147 GCCTTCCTCCGTTAATCCAC Chr9:21585127..21585146 60.83 55
upstream ENSMUSE00000217595 Chr9:21584823..21584913 CCCTGAAGTCAACCAGAGGA Chr9:21584851..21584870 60.23 55
upstream ENSMUSE00000217601 Chr9:21584145..21584381 CACGAGAGCACAGAGAACGA Chr9:21584316..21584335 60.33 55
upstream ENSMUSE00000217592 Chr9:21580145..21580232 CCTCATATCAGCCTGCTTGG Chr9:21580195..21580214 60.76 55
upstream ENSMUSE00000411828 Chr9:21578977..21579196 CGGCGACATCTAGTCACCTT Chr9:21579102..21579121 60.28 55
upstream ENSMUSE00000702616 Chr9:21578977..21579196 CGGCGACATCTAGTCACCTT Chr9:21579102..21579121 60.28 55
upstream ENSMUSE00000376094 Chr9:21577189..21577331 AGACCCAGGACGACATTGAG Chr9:21577240..21577259 60.11 55
upstream ENSMUSE00000702615 Chr9:21577189..21577331 AGACCCAGGACGACATTGAG Chr9:21577240..21577259 60.11 55

*** Putative Vector Insertion (Chr 9: 21574571 - 21577188) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000337246 Chr9:21574370..21574570 GATCTCCTTGTGTCCGTGCT Chr9:21574399..21574418 60.27 55
downstream ENSMUSE00000702614 Chr9:21574370..21574570 GATCTCCTTGTGTCCGTGCT Chr9:21574399..21574418 60.27 55
downstream ENSMUSE00000356457 Chr9:21574198..21574287 GTTCATGCGTGAGTACAGCA Chr9:21574188..21574207 58.44 50
downstream ENSMUSE00000702613 Chr9:21574198..21574287 GTTCATGCGTGAGTACAGCA Chr9:21574188..21574207 58.44 50
downstream ENSMUSE00000394948 Chr9:21571233..21573448 AGAGACTGGTGGGTGTTTGG Chr9:21571352..21571371 60 55
downstream ENSMUSE00000584853 Chr9:21571233..21573448 AGAGACTGGTGGGTGTTTGG Chr9:21571352..21571371 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTGCGGTGGACCTCTATT Chr9:21577161..21577181 59.17 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTGCGGTGGACCTCTATT Chr9:21577161..21577181 59.17 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAATCGCCTTGCAGCACATC Chr9:21574347..21574367 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCATGTGGACAAGCTGAACC Chr9:21574303..21574323 59.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032194