Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19034
Trapped Gene
Pknox1 (ENSMUSG00000006705)
Vector Insertion
Chr 17: 31732270 - 31733740
Public Clones not available
Private Clones OST406582 (lexicon) OST327560 (lexicon)
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000137440 (Chr17:31732170..31732269 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000137440 (Chr17:31732170..31732269 +)
Downstram Exon
ENSMUSE00000137435 (Chr17:31733741..31733838 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657743 Chr17:31701746..31701833 No primer for this exon
upstream ENSMUSE00000657742 Chr17:31720641..31720748 No primer for this exon
upstream ENSMUSE00000137438 Chr17:31725405..31725532 No primer for this exon
upstream ENSMUSE00000137439 Chr17:31727548..31727719 No primer for this exon
upstream ENSMUSE00000137432 Chr17:31729050..31729220 No primer for this exon
upstream ENSMUSE00000137440 Chr17:31732170..31732269 No primer for this exon

*** Putative Vector Insertion (Chr 17: 31732270 - 31733740) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000137435 Chr17:31733741..31733838 No primer for this exon
downstream ENSMUSE00000137433 Chr17:31736460..31736588 No primer for this exon
downstream ENSMUSE00000137441 Chr17:31739731..31739807 No primer for this exon
downstream ENSMUSE00000137436 Chr17:31740132..31740304 No primer for this exon
downstream ENSMUSE00000657741 Chr17:31741698..31742991 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCATCAGCCCTACAACAGG Chr17:31732224..31732244 60.28 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGCAGAAAACCGTGACTG Chr17:31732309..31732329 59.88 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006705